Marasmius tageticolor

Berk. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Marasmius

At a glance

Occurrence records65

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Marasmius tageticolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility65 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF65 records

DNA & barcodingNCBIsequences

01Narrative

Marasmius tageticolor is a species of agaric fungus in the family Marasmiaceae. Its fruit bodies have striped red and white caps. It is found in Mexico, Central America, and South America, where it grows on twigs.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marasmius tageticolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMT260147.1 ↗746 bp

ACGT

TTCTTTGTTTTTCTTTTTAAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAACATTGTAAAG …

Marasmius tageticolor voucher ANGE714 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

08Occurrence & distribution

Record type65 records

Wild obs. + sensor45

Museum / vouchered20

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 14≤1 km 6≤10 km 12>10 km 5

37 georeferenced · 8 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 1

7 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
JBRJlocation not on record	2
FLASlocation not on record	2
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	2
Baton Rouge, US	2
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	2
Pontificia Universidad Javeriana (PUJ)location not on record	1
TENN-Flocation not on record	1
IPA/SPlocation not on record	1
WTUlocation not on record	1
Chicago, US	1
Durango, MX	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
UFSClocation not on record	1

14 institutions · 20 of 20 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)