Marasmius sullivantii

Mont., 1856 · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Marasmius

At a glance

Occurrence records450

Data sources7

Biological traits0

DNA specimens5

eDNA detections6

Sources7 archives

Databases and archives Marasmius sullivantii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility450 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF450 records

Environmental DNA2 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Marasmius sullivantii is a species of fungus in the family Marasmiaceae. The species was originally described by the French botanist Jean Pierre François Camille Montagne in 1856.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marasmius sullivantii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP749083.1 ↗738 bpUSA · 2022

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAAACATTGTAAAGGAGAGTTGAGCTGGTCCTTCAAGGGCAAGT …

Marasmius sullivantii isolate S.D. Russell ONT iNaturalist 128813102 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type450 records

Wild obs. + sensor321

Museum / vouchered129

Range

Area of Occupancy AOO1 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 116≤1 km 46≤10 km 37>10 km 37

236 georeferenced · 85 without coordinates

Open the mapobservation + sensor321

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 1≤1 km 10≤10 km 15>10 km 6

32 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	47
Chicago, US	17
Davis and Elkins Collegelocation not on record	15
Durham, US	10
Bronx, US	7
ILLSlocation not on record	6
Bernard Price Institute for Palaeontological Researchlocation not on record	6
Université de Montréal Biodiversity Centrelocation not on record	4
St. Paul, US	4
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	2
Ann Arbor, US	2
Colorado State Universitylocation not on record	2
Cincinnati, US	1
Champaign, US	1
Toronto, CA	1
FLASlocation not on record	1

16 institutions · 126 of 129 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Marasmius sullivantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 6.70–8.50

Seasonal swing summer↔winter22.2 °C

Max temp (day)13.0 °C 12.0–13.9

Min temp (night)1.60 °C -0.3–3.50

Precipitation89.9 mm/mo 53.8–126

Air humidity56.1 % 53.4–58.8

Moisture balance7.30 mm/mo -26.8–41.4

Vapour deficit508 Pa 494–523

Wind speed2.30 m/s 2.20–2.30

Cloud cover31.9 % 25.1–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)