Marasmius fulvoferrugineus

Gilliam · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Marasmius

At a glance

Occurrence records125

Data sources8

Biological traits0

DNA specimens3

eDNA detections7

Sources8 archives

Databases and archives Marasmius fulvoferrugineus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF125 records

Environmental DNA2 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Marasmius fulvoferrugineus is a species of agaric fungus in the family Marasmiaceae. Described as new to science in 1976, it is found in the southeastern United States. The mushroom is frequently confused with Marasmius siccus, and microscopy is needed to reliably distinguish between them.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marasmius fulvoferrugineus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ450410.1 ↗528 bpChina · 2021

ACGT

TCGCTTCTCTTTCAATCTTCATCCACCTGTGCACATTTTGTAGAGAGTTTGAGAAATGGGCCTAGGTCCAAAGTATCAGGCTTTCTATGT …

Marasmius fulvoferrugineus voucher FH030 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor27

Museum / vouchered98

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy29% within 1 km

≤100 m 3≤1 km 2≤10 km 5>10 km 7

17 georeferenced · 10 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 2≤1 km 9≤10 km 15>10 km 2

28 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence98

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	36
Durham, US	21
Davis and Elkins Collegelocation not on record	12
Chicago, US	9
Blacksburg, US	6
Bronx, US	4
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	3
Mexico City, MX	1
Centro de Estudios Superiores del Estado de Sonoralocation not on record	1
FLASlocation not on record	1
ILLSlocation not on record	1
Colorado State Universitylocation not on record	1
UTFPR-SLlocation not on record	1
Clemson, US	1

14 institutions · 98 of 98 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Marasmius fulvoferrugineus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)