Marasmius cladophyllus

Berk. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Marasmiaceae/Marasmius

At a glance

Occurrence records194

Data sources9

Biological traits0

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Marasmius cladophyllus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility194 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF194 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Marasmius cladophyllus is a species of fungus in the family Marasmiaceae. Found in South America and Central America, it was described as new to science by English mycologist Miles Joseph Berkeley in 1856. A characteristic feature of the mushroom is the prominent ventricose (vein-like) pattern of the gills.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition4 compounds

Compounds documented for Marasmius cladophyllus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Drimane sesquiterpenoids3

Tremulane sesquiterpenoids1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Cladophyllol	present	LOTUS
Cryptoporic acid J	present	LOTUS
Cryptoporic acid K	present	LOTUS
Drimane-3,8,11,12-tetraol	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Marasmius cladophyllus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences10

eDNA detections6

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMF061327.1 ↗212 bpFrench Guiana · 2008

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTGAACGGGGTTGTAGCTGGCCTTCACGGGCATGTGCACACCTCACTCATCCA …

Marasmius cladophyllus voucher G1081 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type194 records

Wild obs. + sensor122

Museum / vouchered72

Range

Area of Occupancy AOO552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 37≤1 km 20≤10 km 12>10 km 21

90 georeferenced · 32 without coordinates

Open the mapobservation + sensor122

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 11≤1 km 1≤10 km 1>10 km 1

14 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	11
EcoFoG FunGuy collectionlocation not on record	10
IPA/SPlocation not on record	8
Bronx, US	7
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	7
Chicago, US	6
Mexico City, MX	5
Colorado State Universitylocation not on record	4
TENN-Flocation not on record	3
Fungario QCAM de la Pontificia Universidad Católica del Ecuadorlocation not on record	2
UFSClocation not on record	2
UFPElocation not on record	1
UFESlocation not on record	1
Guatemala City, GT	1
Kew, GB	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
Copenhagen, DK	1

17 institutions · 71 of 72 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Marasmius cladophyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)