Mamianiella coryli — The Life Data

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Gnomoniaceae/Mamianiella

At a glance

Occurrence records112

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Mamianiella coryli's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility112 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

DNA & barcodingNCBIsequences

01Narrative

Mamianiella coryli is a plant pathogen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mamianiella coryli has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU254862.1 ↗492 bpUSA

ACGT

TCATTGCTGGAGCAAACGCCCCCAGGGGCGCTACCCAGACACCCTGTGTGAATTTTCCACTGTTGCCTCGGCATTGCTGCCCCCGAATGG …

Mamianiella coryli voucher BPI 877578 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor19

Museum / vouchered84

Other9

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 11≤1 km 4≤10 km 1

16 georeferenced · 3 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 12≤10 km 31>10 km 7

50 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tartu, EE	18
Olocation not on record	12
Karlsruhe, DE	9
Helsinki, FI	8
McWane Science Centerlocation not on record	7
Museo Entomologico de Leonlocation not on record	5
LDlocation not on record	5
Champaign, US	4
DPIlocation not on record	4
Kew, GB	3
Bernard Price Institute for Palaeontological Researchlocation not on record	2
Mlocation not on record	1
Vancouver, CA	1
Pullman, US	1
ILLSlocation not on record	1
FLASlocation not on record	1
Uppsala, SE	1
Baton Rouge, US	1

18 institutions · 84 of 84 vouchered records shown