Malva sylvestris
speciesAt a glance
Occurrence records269 922
Data sources16
Biological traits63
DNA specimens64
eDNA detections37
Sources16 archives
Databases and archives Malva sylvestris's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility269 922 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics64 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources63 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS246 compounds
Occurrence & distributionGBIF269 922 records
Environmental DNA1 datasets · 7 countries37 detections
DNA & barcodingBOLD · NCBI64 specimens
Genome at a glanceCCDB · GoaT · NCBI851 Mbp
01Narrative
Malva sylvestris is a species of the mallow genus Malva in the family of Malvaceae and is considered to be the type species for the genus. Known as common mallow to English-speaking Europeans, it acquired the common names of cheeses, high mallow and tall mallow (mauve des bois by the French) as it migrated from its native home in Western Europe, North Africa and Asia through the English-speaking world. M. sylvestris is a vigorous plant with showy flowers of bright mauve-purple, with dark veins, standing 3-4 ft high and growing freely in meadows, hedgerows and in fallow fields.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology21
Fruit width6 mm
Leaf length55 mm
Leaf length max100 mm
Leaf length min50 mm
Leaf mass342 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 7 728 mm² · GIFT: 7 728 mm²
Leaf width65 mm
Leaf width max100 mm
Leaf width min50 mm
Petiole length7.5 cm
Plant height0.627 m
⚠ sources differ — GIFT: 0.627 m · LEDA: 0.6 m · TRY: 0.675 m
Plant height generative0.65 m
Plant height max2.5 m
Plant height min0.2 m
Seed length1.77 mm
Seed mass4.81 mg
⚠ sources differ — TRY: 4.81 mg · LEDA: 3.1 mg · GIFT: 4.26 mg
Seed mass max7.32 mg
Seed mass min3.72 mg
Seed volume5.5 mm³
Seed volume max5.5 mm³
Seed volume min5.5 mm³
Life cycle & reproduction14
Deciduousnessevergreen
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flowering endOct
Flowering startJun
Life formbiennial or perennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: biennial perennial · GIFT: perennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number700
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation mean400 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeschizocarp
⚠ sources differ — AusTraits: schizocarp · GIFT: capsule
Growth formherb
Habitat GIFTcrop fields, forest, mountains, sea, shores, shrubberies, stony places
Leaf compoundnesssimple
Leaf shapeorbicular
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio7.19 g/g
Leaf c451 mg/g
Leaf dry-matter content (LDMC)176 mg/g
Leaf n62.21 mg/g
Leaf p1.6 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)22.61 mm²/mg
Other traits2
Diaspore typemericarp
Shoot orientationascending
03Chemical composition246 compounds
Compounds documented for Malva sylvestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking🌿 Tea
Compound class profile5 classes
Cardenolides46
Unsaturated fatty acids15
Ursane and Taraxastane triterpenoids15
Cytochalasan alkaloids11
Flavonols7
Documented compounds246 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| WATER | 920,000 ppm | DukesPhytochem | |
| PROTEIN | 429,000 ppm | DukesPhytochem | |
| CARBOHYDRATES | 250,000 ppm | DukesPhytochem | |
| FAT | 167,000 ppm | DukesPhytochem | |
| ASH | 155,000 ppm | DukesPhytochem | |
| FIBER | 107,000 ppm | DukesPhytochem | |
| MUCILAGE | 100,000 ppm | DukesPhytochem | |
| ANTHOCYANINS | 70,000 ppm | DukesPhytochem | |
| MALVIDIN-3,5-DIGLUCOSIDE | 35,000 ppm | DukesPhytochem |
05DNA & barcoding64 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malva sylvestris has left across the world's sequence archives.
At a glance
DNA specimens64
Marker genes7
GenBank sequences10
eDNA detections37
Countries11
The DNA barcodea real sequence read deposited for this species
CTCGGGCGGGTGTCCCGGGTTTCGTCGCGCTCCGAGGCAAAACGAACAACCCCCGGCGCGAATCGCGTCAAGGAATAAAAAATGAAAAGA …
Malva sylvestris voucher KS23 HER0357 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★trnL-F★ITS8★ITS2cp-trnL-intron
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Malva sylvestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size850 860 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Malva sylvestris0.85 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidy6× hexaploid · measured
Chromosome records42–422n range42median42mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4245×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XVI. Malvaceae Queirs, M.Bol. Soc. Brot. ser. 251: 187-199(1977).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2138
CCDB · fl-europaea — Lovkvist, 1963
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Markova, M. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 761.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · ipcn-api-dl — Markova, M. L. & V. Y. Goranova. 1993. Karyological study of representatives of family Malvaceae in Bulgaria. Fitologija 46: 12–32.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1986. Chromosome numbers of the vascular plants from the far east of the USSR. Bot. Zhurn. SSSR 71: 1572–1575.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn67-71 — VAN LOON, J.C., T.W.J. GADELLA, & E. KLIPHUIS. 1971. Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · book-ipcn75-78 — Queiros 1977
CCDB · book-ipcn75-78 — Uhrikova 1978
CCDB · book-ipcn73-74 — FRITSCH, R.M. 1973. In IOPB chromosome number reports XLI. Taxon 459-464.
CCDB · book-indian_vol1 — Latter, J. 1932 ; Davie, J.H. 1933 ; Tischler, G. 1934; Skovsted, A. 1935, 1941 ; Delay, C. 1947 ; Roy, R.P. & Sinha, R.P. 1961 ; Majovsky, J. et al. 1970b; Skalinska, M. et al. 1971; Van Loon, J.C. et al. 1971 ; Van Loon, 1. Chr. & Kieft, B. 1980
CCDB · book-indian_vol1 — Fritsch, R.M. 1973
CCDB · book-fedorov — Latter 1932
CCDB · book-fedorov — Davie 1933
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Skovsted 1935, 1941
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Roy R. P., Sinha R. P. 1961
CCDB · book-atlas-flowering-plants
CCDB · kew — Ceccarelli M, Morosi L, Cionini PG. 1998. Chromocenter association in plant cell nuclei: determinants, functional significance, and evolutionary implications. Genome 41: 96-103.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Loon van, J. C., Gadella, Th. W. J. & Kliphuis, E. (1971). Cytological studies in some flowering plants from Southern France. Acta Bot. Neerl. 20: 157-166.
CCDB · CromoCat 2015 — Markova, M. (1982a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 761.
CCDB · CromoCat 2015 — Queirós, M. (1977). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XVI. Malvaceae. Bol. Soc. Brot. 51: 187-199.
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
CCDB · CromoCat 2015 — Skalinska, M., A. Jankun, H. Wcislo. (1971). Studies in chromosome numbers of Polish angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
CCDB · CromoCat 2015 — Davie, J. H. (1933). Cytological studies in the Malvaceae and certain related families. J. Genet. 28: 33-67.
+3 more references
n 212×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Sidhu, M. K., R. C. Gupta & N. Goyal. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145.
CCDB · CromoCat 2015 — Sidhu, M.K.R., R.C. Gupta & N. Goyal (1990). SOCGI plant chromosome number reports- IX J. Cytol. Genet. 25:145
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.931 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.6% BUSCO
07Deep time~1.27 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.27 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type269 922 records
Wild obs. + sensor263 112
Museum / vouchered6 092
Cultivated / captive80
Other638
Origin
Native2 670
Introduced7 361
Range
Area of Occupancy AOO318 792 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 52 491≤1 km 39 915≤10 km 136 063>10 km 1 663
230 132 georeferenced · 32 980 without coordinates
Open the mapobservation + sensor263 112
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 284≤1 km 904≤10 km 1 295>10 km 125
2 608 georeferenced · 3 484 without coordinates
Open the institutions mapphysical evidence6 092
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤1 km 3≤10 km 20>10 km 16
39 georeferenced · 41 without coordinates
Open the mapnot free-living80
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions169 of 291 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 618 |
| BIO-UNIPIlocation not on record | 501 |
| Uniwersytet Wrocławskilocation not on record | 380 |
| LDlocation not on record | 367 |
| Olocation not on record | 166 |
| MeiseBGlocation not on record | 155 |
| BFLlocation not on record | 146 |
| MAlocation not on record | 121 |
| Moscow State Universitylocation not on record | 118 |
| Oskarshamn, SE | 104 |
| València, ES | 97 |
| College of the Atlantic, Museumlocation not on record | 94 |
| KMNlocation not on record | 90 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 85 |
| BDBClocation not on record | 74 |
| Görlitz, DE | 72 |
| Entomological Society of Latvialocation not on record | 68 |
| South Kensington, GB | 59 |
| Museo Entomologico de Leonlocation not on record | 57 |
| BClocation not on record | 53 |
| Uniwersytet Warszawskilocation not on record | 51 |
| Salzburg, AT | 45 |
| Barcelona, ES | 45 |
| Helsinki, FI | 43 |
| GJOlocation not on record | 42 |
| Karlsruhe, DE | 42 |
| SLU Artdatabankenlocation not on record | 41 |
| Christchurch, NZ | 41 |
| Pamplona, ES | 40 |
| Bern, CH | 38 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 37 |
| BRNUlocation not on record | 34 |
| Salamanca, ES | 33 |
| UGentlocation not on record | 32 |
| Trondheim, NO | 31 |
| Granada, ES | 31 |
| Wlocation not on record | 31 |
| Hobart, AU | 30 |
| Córdoba, ES | 30 |
| Philadelphia, US | 29 |
| Bergen, NO | 29 |
| Pullman, US | 26 |
| Auckland, NZ | 26 |
| Vitoria, ES | 26 |
| Badajoz, ES | 25 |
| CICYTEXlocation not on record | 25 |
| Uniwersytet Jagiellońskilocation not on record | 24 |
| Wellington, NZ | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Natural History Museum Rotterdamlocation not on record | 21 |
| ISAlocation not on record | 20 |
| University of Stellenboschlocation not on record | 20 |
| Madrid, ES | 19 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 19 |
| Saint Louis, US | 19 |
| Alicante, ES | 17 |
| UIBlocation not on record | 17 |
| Uppsala, SE | 17 |
| Bronx, US | 16 |
| Phyletisches Museum Jenalocation not on record | 16 |
| Zürich, CH | 16 |
| Provincia di Livornolocation not on record | 16 |
| WTUlocation not on record | 15 |
| Santa Barbara, US | 15 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| Pamplona, ES | 14 |
| University of New Hampshirelocation not on record | 13 |
| Mount Annan, AU | 13 |
| Davis, US | 12 |
| Universidad de Caldas (UCaldas)location not on record | 12 |
| St. Paul, US | 12 |
| Zürich, CH | 11 |
| Porrentruy, CH | 11 |
| Brisbane, AU | 11 |
| Burlington, US | 11 |
| Turku, FI | 10 |
| Mlocation not on record | 10 |
| Corvallis, US | 10 |
| Chongqing Museumlocation not on record | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Claremont, US | 9 |
| Mexico City, MX | 9 |
| Kew, GB | 9 |
| New Haven, US | 9 |
| Dresden, DE | 9 |
| Frankfurt am Main | 9 |
| Tilburg, NL | 9 |
| Córdoba, AR | 9 |
| Canberra, AU | 9 |
| CJBGlocation not on record | 8 |
| BSBIlocation not on record | 8 |
| Universidad Católica de Oriente (UCO)location not on record | 8 |
| Rotorua, NZ | 8 |
| Palmerston North, NZ | 8 |
| Urumqi, CN | 7 |
| Bloomington, US | 7 |
| Durango, MX | 7 |
| Bozeman, US | 7 |
| TUR-Alocation not on record | 6 |
| Riverside, US | 6 |
| Victoria, CA | 6 |
| UNESClocation not on record | 6 |
| Beijing, CN | 6 |
| Wuhan, CN | 6 |
| Frauenfeld, CH | 6 |
| Criciúma, BR | 6 |
| TROMlocation not on record | 5 |
| Tartu, EE | 5 |
| Ann Arbor, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Philadelphia, US | 5 |
| Wuzhou, CN | 5 |
| Bourges, FR | 5 |
| OLAlocation not on record | 5 |
| Nagano City, JP | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Oulu, FI | 4 |
| Nijmegen, NL | 4 |
| Rishon Le Zion, IL | 4 |
| EEZA-CSIClocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Universite de Montpellierlocation not on record | 4 |
| Porvoo, FI | 4 |
| Glarus, CH | 4 |
| GMBAlocation not on record | 4 |
| JBSlocation not on record | 4 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| San Diego, US | 4 |
| Podgorica, ME | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Gijón, ES | 3 |
| Allentown, US | 3 |
| Chicago, US | 3 |
| Spearfish, US | 3 |
| Masindi, UG | 3 |
| Mexico City, MX | 3 |
| Sion, CH | 3 |
| Paris, FR | 3 |
| Vancouver, CA | 3 |
| Pretoria, ZA | 3 |
| Tallinn, EE | 3 |
| Xiamen, CN | 3 |
| Phoenix, US | 3 |
| Northridge, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Göteborg, SE | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Jaén, ES | 3 |
| Wuhan, CN | 3 |
| Staten Island, US | 3 |
| Henry Brockhouse Collectionlocation not on record | 3 |
| ESP109location not on record | 3 |
| Durham, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| GZUlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Portland, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Sevilla, ES | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Madison, US | 3 |
| Dekalb, US | 2 |
| UTPLlocation not on record | 2 |
| Uberlândia, BR | 2 |
| Ivano-Frankivsk, UA | 2 |
| Millersville, US | 2 |
| Guatemala City, GT | 2 |
| Tampa, US | 2 |
| Columbia, US | 2 |
| CASlocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Stockholm, SE | 2 |
| Chadron, US | 2 |
| Albuquerque, US | 2 |
| Mississippi State, US | 2 |
| EL PASO, US | 2 |
| Kuopio, FI | 2 |
| LfUlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| KR | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| JBRJlocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Fort Worth, US | 2 |
| Winterthur, CH | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| San Isidro, AR | 2 |
| PRClocation not on record | 2 |
| SNSNMClocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Monastir, TN | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Jyväskylä, FI | 2 |
| Namur, BE | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| Long Beach, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Davenport, US | 2 |
| Toronto, CA | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Santa Cruz, US | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Xining, CN | 2 |
| Aarhus, DK | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Banyoles, ES | 1 |
| IPE-CSIClocation not on record | 1 |
| Cape Town, ZA | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Durban, ZA | 1 |
| Fribourg, CH | 1 |
| University of Patraslocation not on record | 1 |
| ROM007location not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Hudson, US | 1 |
| Logan, US | 1 |
| San Francisco, US | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| Denver, US | 1 |
| Irvine, US | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Taipei, TW | 1 |
| Fukushima Universitylocation not on record | 1 |
| San Angelo, US | 1 |
| Tsukuba, JP | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| JBAlocation not on record | 1 |
| Kathmandu, NP | 1 |
| Boise, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Dublin, IE | 1 |
| University of Genevalocation not on record | 1 |
| Flagstaff, US | 1 |
| MHNAIXlocation not on record | 1 |
| Provo, US | 1 |
| Chicago, US | 1 |
| Tuscaloosa, US | 1 |
| Henderson, US | 1 |
| Chapel Hill, US | 1 |
| Turlock, US | 1 |
| Macomb, US | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Adelaide, AU | 1 |
| Cuenca, EC | 1 |
| Musée des Confluenceslocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Smithfield, AU | 1 |
| Lake Charles, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Nanjing, CN | 1 |
| ESP004location not on record | 1 |
| JBCLMlocation not on record | 1 |
| Brookings, US | 1 |
| UFOPlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Shinshu Universitylocation not on record | 1 |
| Philadelphia, US | 1 |
| Armidale, AU | 1 |
| Edinburgh, GB | 1 |
| Bangkok, TH | 1 |
| QVMAGlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Austin, US | 1 |
| Guangzhou, CN | 1 |
| GB | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Palmerston, AU | 1 |
| FUVATESlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Montréal, CA | 1 |
| Green Bay, US | 1 |
| Clemson, US | 1 |
| Angwin, US | 1 |
| ASUlocation not on record | 1 |
| Saint John, CA | 1 |
291 institutions · 5 427 of 6 092 vouchered records shown · 482 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA37 detections
Where the DNA of Malva sylvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found37
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 37 detections have coordinates
Open the map7 countries0
Roadside vergeUrban parks and large gardensDry calcareous grasslands
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.2 °C 11.1–21.1
Seasonal swing summer↔winter17.2 °C
Max temp (day)20.6 °C 14.0–25.8
Min temp (night)12.7 °C 9.10–15.2
Precipitation72.7 mm/mo 38.4–119
Air humidity59.6 % 53.9–64.2
Moisture balance-41.5 mm/mo -124–41.7
Vapour deficit735 Pa 525–1,155
Wind speed3.10 m/s 2.70–6.50
Cloud cover42.3 % 38.0–51.7
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.