Malva neglecta
Wallr. · speciesAt a glance
Occurrence records140 024
Data sources14
Biological traits60
DNA specimens47
eDNA detections22
Sources14 archives
Databases and archives Malva neglecta's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility140 024 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics47 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Chemical compositionDukesPhytochem · LOTUS12 compounds
Occurrence & distributionGBIF140 024 records
Environmental DNA1 datasets · 7 countries22 detections
DNA & barcodingBOLD · NCBI47 specimens
Genome at a glanceCCDB · GoaT · NCBI665 Mbp
01Narrative
Malva neglecta is an annual growing to 0.6 m (2 ft). It is known as common mallow in the United States and also as buttonweed, cheeseplant, cheeseweed, dwarf mallow, and roundleaf mallow. This plant is often consumed as a food, with its leaves, stalks and seed all being considered edible.Facciola S. Cornucopia – A Source Book of Edible Plants. Vista, Ca. Kampong Publications, 1990. 677 p.Archived at Ghostarchive and the Wayback Machine: This is especially true of the seeds, which contain 21% protein and 15.2% fat.Duke JA. CRC Handbook of Proximate Analysis Tables of Higher Plants. Boca Raton, Fl. CRC Press, 1986. 389 p.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology17
Fruit width6.5 mm
Leaf length40 mm
Leaf length max70 mm
Leaf length min4 mm
Leaf mass6.84 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 162 mm² · GIFT: 162 mm²
Leaf width35 mm
Leaf width max50 mm
Leaf width min5 mm
Plant height0.332 m
⚠ sources differ — GIFT: 0.332 m · LEDA: 0.325 m · TRY: 0.177 m
Plant height generative0.325 m
Plant height max1 m
Plant height min0.05 m
Seed length1.75 mm
Seed mass2.31 mg
⚠ sources differ — TRY: 2.31 mg · AusTraits: 2.85 mg · LEDA: 2.4 mg · GIFT: 2.27 mg
Seed mass max2.66 mg
Seed mass min1.9 mg
Life cycle & reproduction18
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flower colourpink
Flower length max11 mm
Flower length min7 mm
Flowering endSep
Flowering startJun
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: annual
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number400
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeschizocarp
⚠ sources differ — AusTraits: schizocarp · GIFT: capsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlobed
Leaf shapeorbicular
Mycorrhiza type0.000000805
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)214 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)9.6 mm²/mg
⚠ sources differ — TRY: 9.6 mm²/mg · LEDA: 23.7 mm²/mg · GIFT: 23.7 mm²/mg
Other traits4
Diaspore typemericarp
Shoot length max50 cm
Shoot length min15 cm
Shoot orientationascending
03Chemical composition12 compounds
Compounds documented for Malva neglecta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile3 classes
Stigmastane steroids1
Hydrocarbons1
Monosaccharides1
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| PROTEIN | 210,000 ppm | DukesPhytochem | |
| ASH | 174,500 ppm | DukesPhytochem | |
| FAT | 152,000 ppm | DukesPhytochem | |
| NITROGEN | 4,200 ppm | DukesPhytochem | |
| ASCORBIC-ACID | 1,175 ppm | DukesPhytochem |
05DNA & barcoding47 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malva neglecta has left across the world's sequence archives.
At a glance
DNA specimens47
Marker genes8
GenBank sequences10
eDNA detections22
Countries9
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATC …
Malva neglecta voucher RBG-Blitz 002WP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Malva neglecta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size665 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Malva neglecta0.67 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Ploidypolyploid inferred
Chromosome records42–422n range42median42mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4231×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2142
CCDB · fl-europaea — Lovkvist, 1963
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · poland — Adamkiewicz E. and Bijok K. 1971. Badania kariologiczne nad trzema gatunkami rodzaju Malva L. Acta Soc. Bot. Pol. 40, 395-400.
CCDB · ipcn-api-dl — Markova, M. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 761.
CCDB · ipcn-api-dl — Markova, M. L. & V. Y. Goranova. 1993. Karyological study of representatives of family Malvaceae in Bulgaria. Fitologija 46: 12–32.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · book-ipcn67-71 — GADELLA, TH. W.J., & E. KLIPHUIS. 1970. Cytotaxonomic investigations in some angiosperms collected in the Valley of Aosta and in the National Park "Gran Paradiso". Carylogia 23: 363-379.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — ADAMKIEWICZ, E., & K. BIJOK. 1971. Badania Kariologiczne nad trzema gatunkami rodzaju Malva L. [Karyological studies in three species of the genus Malva L. I Acta soc. Bot. Poloniae 40:----r9"5-400.
CCDB · book-ipcn67-71 — SKALINSKA, M., A. JANKUN, H. WCISLO ET AL. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-fedorov — Tischler 1934, 1937
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-fedorov — Mulligan 1961a
CCDB · book-atlas-flowering-plants — Eur., Asia, N. Afr.
CCDB · CromoCat 2015 — Markova, M. (1982a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 761.
CCDB · CromoCat 2015 — Adamkiewicz, E. & Bijok, K. (1971). Karyological studies in three species of the genus Malva L. Acta Soc. Bot. Poloniae 40: 395-400.
CCDB · CromoCat 2015 — Davie, J. H. (1933). Cytological studies in the Malvaceae and certain related families. J. Genet. 28: 33-67.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1970b). Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park "Gran Paradisio". Caryologia 23: 363-379.
CCDB · CromoCat 2015 — Skalinska, M., A. Jankun, H. Wcislo. (1971). Studies in chromosome numbers of Polish angiosperms. Eighth contribution. Acta Biol. Cracov., Ser. Bot. 14: 55-102.
CCDB · CromoCat 2015 — Skovsted, A. (1935). Chromosome numbers in the Malvaceae. I. J. Genet. 31 (2): 263-296.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
CCDB · CromoCat 2015 — Talavera, S. (1977). Números cromosómicos para la flora española, 18-23. Lagascalia 7(2): 201-203.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
n 213×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
n 421×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.931 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.7% BUSCO
07Deep time~1.27 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.27 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type140 024 records
Wild obs. + sensor131 642
Museum / vouchered7 886
Cultivated / captive18
Other478
Origin
Native1 054
Introduced4 175
Range
Area of Occupancy AOO227 236 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy30% within 1 km
≤100 m 17 578≤1 km 16 472≤10 km 76 694>10 km 1 131
111 875 georeferenced · 19 767 without coordinates
Open the mapobservation + sensor131 642
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 464≤1 km 1 202≤10 km 2 503>10 km 183
4 352 georeferenced · 3 534 without coordinates
Open the institutions mapphysical evidence7 886
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤100 m 1≤1 km 1≤10 km 2
4 georeferenced · 14 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions218 of 349 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 072 |
| LDlocation not on record | 305 |
| BFLlocation not on record | 252 |
| Philadelphia, US | 155 |
| SLU Artdatabankenlocation not on record | 152 |
| Berlin, DE | 151 |
| Wuzhou, CN | 139 |
| Madison, US | 120 |
| MeiseBGlocation not on record | 120 |
| Moscow State Universitylocation not on record | 115 |
| Oskarshamn, SE | 112 |
| BIO-UNIPIlocation not on record | 104 |
| Olocation not on record | 103 |
| Adam Mickiewicz University in Poznańlocation not on record | 101 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 96 |
| Uniwersytet Warszawskilocation not on record | 93 |
| València, ES | 89 |
| Görlitz, DE | 81 |
| Museo Entomologico de Leonlocation not on record | 80 |
| Pullman, US | 78 |
| Bronx, US | 74 |
| Chongqing Museumlocation not on record | 74 |
| MAlocation not on record | 68 |
| Salzburg, AT | 66 |
| Québec, CA | 64 |
| Odawara, JP | 56 |
| Denver, US | 54 |
| KMNlocation not on record | 54 |
| Helsinki, FI | 53 |
| Entomological Society of Latvialocation not on record | 51 |
| Bloomington, US | 50 |
| Canberra, AU | 50 |
| Corvallis, US | 50 |
| Ann Arbor, US | 48 |
| Chadron, US | 47 |
| Nagano City, JP | 47 |
| GMBAlocation not on record | 46 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 46 |
| Flagstaff, US | 45 |
| Mount Annan, AU | 44 |
| Barcelona, ES | 44 |
| University of New Hampshirelocation not on record | 43 |
| BDBClocation not on record | 43 |
| Spearfish, US | 42 |
| Burlington, US | 41 |
| WTUlocation not on record | 39 |
| St. Paul, US | 39 |
| Provincia di Livornolocation not on record | 39 |
| South Kensington, GB | 38 |
| Lausanne, CH | 37 |
| Wlocation not on record | 35 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 35 |
| Albuquerque, US | 34 |
| College Park, US | 34 |
| Auckland, NZ | 34 |
| DBF-NHMDlocation not on record | 34 |
| ASUlocation not on record | 31 |
| Pretoria, ZA | 29 |
| BRNUlocation not on record | 29 |
| Trondheim, NO | 27 |
| Allentown, US | 27 |
| Riverside, US | 27 |
| Bergen, NO | 27 |
| Uniwersytet Jagiellońskilocation not on record | 26 |
| Karlsruhe, DE | 26 |
| Moscow, US | 26 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 25 |
| Saint Louis, US | 25 |
| Provo, US | 25 |
| University of Stellenboschlocation not on record | 25 |
| Salamanca, ES | 24 |
| Granada, ES | 24 |
| Claremont, US | 24 |
| Université Lavallocation not on record | 23 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 22 |
| Bern, CH | 21 |
| Williamsburg, US | 21 |
| Tsukuba, JP | 20 |
| Canadian Department of Agriculturelocation not on record | 20 |
| Shinshu Universitylocation not on record | 20 |
| Zürich, CH | 19 |
| Fort Worth, US | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Christchurch, NZ | 18 |
| Portland, US | 18 |
| Emporia, US | 18 |
| BClocation not on record | 17 |
| Tartu, EE | 16 |
| Vitoria, ES | 16 |
| Chiba, JP | 16 |
| Logan, US | 15 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 15 |
| GJOlocation not on record | 15 |
| DOI/NPS, Greenbelt Parklocation not on record | 15 |
| New Haven, US | 15 |
| Pocatello, US | 15 |
| EL PASO, US | 15 |
| Acadia Universitylocation not on record | 14 |
| Pamplona, ES | 14 |
| Tomioka, JP | 14 |
| Adelaide, AU | 13 |
| Santa Barbara, US | 13 |
| Phoenix, US | 13 |
| Uppsala, SE | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 13 |
| Kawasaki Shi Tama Ku, JP | 13 |
| Taipei, TW | 13 |
| Philadelphia, US | 13 |
| Stockholm, SE | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Mlocation not on record | 12 |
| Frankfurt am Main | 12 |
| Missoula, US | 12 |
| Otaru, JP | 12 |
| JP | 12 |
| Victoria, CA | 11 |
| Boise, US | 11 |
| Madrid, ES | 11 |
| Austin, US | 11 |
| Turku, FI | 11 |
| Zürich, CH | 11 |
| Hazara Universitylocation not on record | 10 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 10 |
| Hobart, AU | 10 |
| Davis, US | 10 |
| Toronto, CA | 10 |
| Kew, GB | 9 |
| GB | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Chapel Hill, US | 9 |
| Dekalb, US | 9 |
| Phyletisches Museum Jenalocation not on record | 9 |
| Bangkok, TH | 9 |
| Millersville, US | 9 |
| Tokushima, JP | 8 |
| Wellington, NZ | 8 |
| Durango, US | 8 |
| Vancouver, CA | 8 |
| IDElocation not on record | 8 |
| McWane Science Centerlocation not on record | 8 |
| San Isidro, AR | 8 |
| Cheney, US | 8 |
| Brisbane, AU | 8 |
| Hiratsuka City Museumlocation not on record | 8 |
| Montréal, CA | 8 |
| EEZA-CSIClocation not on record | 8 |
| Bando, JP | 8 |
| Macomb, US | 7 |
| CICYTEXlocation not on record | 7 |
| Kirksville, US | 7 |
| Whitewater, US | 7 |
| Washington, US | 7 |
| Tilburg, NL | 7 |
| San Diego, US | 7 |
| Kunming, CN | 7 |
| Urumqi, CN | 7 |
| San Luis Obispo, US | 6 |
| Armidale, AU | 6 |
| Rotorua, NZ | 6 |
| Arcata, US | 6 |
| University of Wisconsinlocation not on record | 6 |
| Museum of the Rockieslocation not on record | 6 |
| Lubbock, US | 6 |
| Tacoma, US | 6 |
| CJBGlocation not on record | 6 |
| Oulu, FI | 6 |
| TAIElocation not on record | 6 |
| Hudson, US | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| San Angelo, US | 6 |
| Caldwell, US | 6 |
| Green Bay, US | 6 |
| Grand Junction, US | 6 |
| Sagamihara, JP | 5 |
| Orem, US | 5 |
| Angwin, US | 5 |
| Fulda, DE | 5 |
| Mount Pleasant, US | 5 |
| Beijing, CN | 5 |
| Frauenfeld, CH | 5 |
| Nijmegen, NL | 5 |
| Edinburgh, GB | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| TUR-Alocation not on record | 5 |
| Durango, MX | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Bend, US | 4 |
| Glarus, CH | 4 |
| BISHlocation not on record | 4 |
| Córdoba, AR | 4 |
| Long Beach, US | 4 |
| Porrentruy, CH | 4 |
| Durham, US | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| PRClocation not on record | 4 |
| Northridge, US | 4 |
| Lanzhou, CN | 4 |
| ISAlocation not on record | 4 |
| Kochi, JP | 4 |
| LfUlocation not on record | 4 |
| Fukushima Universitylocation not on record | 4 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| CASlocation not on record | 4 |
| Urumqi, CN | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Taipei, TW | 4 |
| Nagatoro-machi, Chichibu-gun, JP | 4 |
| Bozeman, US | 4 |
| Saint John, CA | 4 |
| Honolulu, US | 4 |
| Norfolk, US | 4 |
| Fayetteville, US | 3 |
| Sion, CH | 3 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 3 |
| Columbia, US | 3 |
| Göteborg, SE | 3 |
| BAYLUlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Puebla, MX | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Alicante, ES | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| BGBMlocation not on record | 3 |
| Toyama, JP | 3 |
| Oswego, US | 3 |
| Osaka, JP | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Chicago, US | 3 |
| Turlock, US | 3 |
| Walla Walla, US | 3 |
| Keene State Universitylocation not on record | 3 |
| Bourges, FR | 3 |
| UoB-IBlocation not on record | 2 |
| Porvoo, FI | 2 |
| Little Rock, US | 2 |
| Sevilla, ES | 2 |
| USFSlocation not on record | 2 |
| Cambridge, US | 2 |
| Philadelphia, US | 2 |
| Ypsilanti, US | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Durban, ZA | 2 |
| Museo Achille Folettolocation not on record | 2 |
| US | 2 |
| Pamplona, ES | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Tallinn, EE | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Xiamen, CN | 2 |
| Dresden, DE | 2 |
| QVMAGlocation not on record | 2 |
| Whitehorse, CA | 2 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 2 |
| Voronezh State Universitylocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Taipei, TW | 2 |
| NMBU:MINAlocation not on record | 2 |
| Sanda, JP | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Edmonton, CA | 2 |
| TROMlocation not on record | 2 |
| Lincoln, US | 2 |
| Mexico City, MX | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Chicago, US | 2 |
| Ashland, US | 2 |
| Anchorage, US | 2 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Springfield, US | 2 |
| Johnson City, US | 1 |
| Mexico City, MX | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Davenport, US | 1 |
| Brookings, US | 1 |
| Banyoles, ES | 1 |
| Irvine, US | 1 |
| Guasave, MX | 1 |
| VALElocation not on record | 1 |
| Fairfax, US | 1 |
| Montréal, CA | 1 |
| University of Balochistanlocation not on record | 1 |
| Gijón, ES | 1 |
| PrivatHerblocation not on record | 1 |
| Podgorica, ME | 1 |
| München, DE | 1 |
| Jefferson City, US | 1 |
| Minia, EG | 1 |
| CJBNlocation not on record | 1 |
| Namur, BE | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Brussel, BE | 1 |
| OLAlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Parkville, AU | 1 |
| Corrientes, AR | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| UIBlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Castelar, AR | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Pittsburg, US | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Knoxville, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| BSBIlocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| KNFYlocation not on record | 1 |
| University of Johannesburglocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| USFS/BHSClocation not on record | 1 |
| Tempe, US | 1 |
| Rishon Le Zion, IL | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Turpan Eremophytes Botanical Garden, Herbariumlocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Badajoz, ES | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Chicago, US | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Henderson, US | 1 |
| Mexico City, MX | 1 |
| La Paz, BO | 1 |
| Richmond, US | 1 |
| Jyväskylä, FI | 1 |
| Waverly, US | 1 |
| Mississippi State, US | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Cape Town, ZA | 1 |
| AZE014location not on record | 1 |
| WNNUlocation not on record | 1 |
| FLADlocation not on record | 1 |
| US | 1 |
| Mérida, MX | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Muzaffarabad, PK | 1 |
| Kingston, US | 1 |
| Bothell, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Portland, US | 1 |
349 institutions · 7 164 of 7 886 vouchered records shown · 571 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Malva neglecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map7 countries0
ruderal siteForest belt
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.0 °C 11.7–20.5
Seasonal swing summer↔winter20.4 °C
Max temp (day)18.8 °C 14.6–25.8
Min temp (night)12.9 °C 5.20–16.4
Precipitation77.3 mm/mo 18.9–97.9
Air humidity60.6 % 48.7–63.8
Moisture balance-45.7 mm/mo -74.4–51.0
Vapour deficit735 Pa 498–1,051
Wind speed3.70 m/s 2.40–6.80
Cloud cover42.9 % 34.6–54.4
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.