Malva hispanica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Malva

At a glance

Occurrence records1 774

Data sources10

Biological traits7

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Malva hispanica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 774 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF1 774 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Malva hispanica (лат.) — вид растений рода Мальва (Malva) семейства Мальвовые (Malvaceae). Однолетнее травянистое растение. Стебель прямой, 0,7-0,9 (1) м, простой или ветвистый от основания, густо опушенный. Цветы 1,5-3 см в диаметре, одиночные. Лепестки 15-25 мм, обратнояйцевидные, выемчатые, розовые. Полуплодики[прояснить] 11-16 2-2,5 мм в диаметре, голые, жёлтые при созревании. Вид распространён на Пиренейском полуострове, в северо-восточной Африке. Населяет кустарники и луга на песчаных почвах и кремнезёме на высотах 0-1400 м над уровнем моря.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Forb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malva hispanica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSEF419488.1 ↗712 bp

ACGT

CGTAGGTGACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGTGATGTCAAACACAACCAGTCGAGGGGGTG …

Malva hispanica isolate IMhi0149 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Malva hispanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · iber-fl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XVI. Malvaceae Queirs, M.Bol. Soc. Brot. ser. 251: 187-199(1977).

CCDB · book-ipcn75-78 — Queiros 1977

CCDB · CromoCat 2015 — Queirós, M. (1977). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XVI. Malvaceae. Bol. Soc. Brot. 51: 187-199.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 774 records

Wild obs. + sensor1 312

Museum / vouchered461

Other1

Origin

Native61

Range

Area of Occupancy AOO4 824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 553≤1 km 148≤10 km 241>10 km 15

957 georeferenced · 355 without coordinates

Open the mapobservation + sensor1 312

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 10≤1 km 121≤10 km 64>10 km 2

197 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence461

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	76
BClocation not on record	49
CICYTEXlocation not on record	40
College of the Atlantic, Museumlocation not on record	37
ISAlocation not on record	37
Badajoz, ES	32
Córdoba, ES	31
Sevilla, ES	20
Madrid, ES	19
Salamanca, ES	18
Wlocation not on record	15
València, ES	12
Barcelona, ES	11
Jaén, ES	6
Museo Achille Folettolocation not on record	6
Coimbra, PT	5
Granada, ES	5
Paris, FR	4
Saint Louis, US	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
BDBClocation not on record	3
Kew, GB	3
Alicante, ES	3
Entomological Society of Latvialocation not on record	3
Vitoria, ES	2
Phyletisches Museum Jenalocation not on record	2
MeiseBGlocation not on record	2
San Diego, US	1
RABATlocation not on record	1
Tilburg, NL	1
Taipei, TW	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Bourges, FR	1
Wellington, NZ	1
Bronx, US	1
ESP003location not on record	1

36 institutions · 458 of 461 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Malva hispanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Malva hispanica

At a glance

Sources10 archives

Life cycle & reproduction3

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 774 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 774 records