Malva cretica

Cav. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Malva

At a glance

Occurrence records394

Data sources5

Biological traits8

DNA specimens1

eDNA detections3

Sources5 archives

Databases and archives Malva cretica's data was compiled from.

GBIFGlobal Biodiversity Information Facility394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF394 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceNCBI≈838 Mbp

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malva cretica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEF419515.1 ↗717 bp

ACGT

CGTAGGTGACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGTGATATCAAACAACTAATCGAGGGGGTGCG …

Malva cretica subsp. althaeoides isolate IMca391 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS4

plant barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Malva cretica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈838 294 819 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Malva cretica0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type394 records

Wild obs. + sensor223

Museum / vouchered168

Other3

Origin

Native21

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 67≤1 km 46≤10 km 45>10 km 9

167 georeferenced · 56 without coordinates

Open the mapobservation + sensor223

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 2≤1 km 4≤10 km 3

9 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence168

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	103
BIO-UNIPIlocation not on record	26
Berlin, DE	11
Wlocation not on record	6
València, ES	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
MAlocation not on record	2
BRNUlocation not on record	2
Sevilla, ES	2
Alicante, ES	1
Bergen, NO	1
BDBClocation not on record	1
Görlitz, DE	1
Salamanca, ES	1
BClocation not on record	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
Trondheim, NO	1

17 institutions · 166 of 168 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Malva cretica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)