Malus transitoria

(Batalin) C.K.Schneid. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Malus

At a glance

Occurrence records503

Data sources12

Biological traits22

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Malus transitoria's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility503 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF503 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB · GoaT · NCBI786 Mbp

01Narrative

Malus transitoria, the cut-leaf crabapple, is a species of flowering plant in the crabapple genus Malus of the family Rosaceae, native to China. The Latin transitoria means "short-lived". The name "cut-leaf" refers to the shape of the leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit length7 mm

Fruit length max8 mm

Fruit length min6 mm

Fruit width7 mm

Fruit width max8 mm

Fruit width min6 mm

Leaf width max45 mm

Leaf width min20 mm

Plant height8 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flower length max20 mm

Flower length min10 mm

Life formshrub or tree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max3 900 m

Elevation mean2 700 m

Elevation min1 500 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malus transitoria has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes3

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW390037.1 ↗686 bp

ACGT

GCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGCATTTCGAGTAACTCCT …

Malus transitoria voucher WYJ201807394 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Malus transitoria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size786 067 500 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Malus transitoria0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Höfer M, Meister A. 2010. Genome size variation in Malus species. Journal of Botany 2010: Article ID 480873.

2n 512×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liang, G. l. 1987. Observations of chromosomes of Malus species in China. Acta Phytotax. Sin. 25: 437–441.

CCDB · ipcn-api-dl — Liang, G. l. 1986. Comparative studies of karyotypes in Chinese species of Malus. J. SouthW. Agric. Univ. (1): 104–117.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type503 records

Wild obs. + sensor25

Museum / vouchered169

Cultivated / captive9

Other300

Origin

Native206

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤1 km 23≤10 km 2

25 georeferenced

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 169 records without

Open the institutions mapphysical evidence169

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 4 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yangling, CN	56
Beijing, CN	53
Chengdu, CN	15
Chengdu, CN	8
Xining, CN	8
Kunming, CN	7
Wuhan, CN	3
Xian, CN	3
Nanjing, CN	3
Cambridge, US	2
Paris, FR	2
Guilin, CN	1
Beijing Normal Universitylocation not on record	1
Lanzhou, CN	1
Saint Louis, US	1
Rotorua, NZ	1
Philadelphia, US	1
Seoul, KR	1

18 institutions · 167 of 169 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Malus transitoria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)