Malus spectabilis

(Aiton) Borkh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Malus

At a glance

Occurrence records140

Data sources11

Biological traits27

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Malus spectabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility140 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF140 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · NCBI792 Mbp

01Narrative

Malus spectabilis, le Pommier remarquable ou Pommier de Chine, est une espèce de plantes à fleurs de la famille des Rosaceae originaire de Chine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length20 mm

Fruit length max20 mm

Fruit length min20 mm

Fruit width20 mm

Fruit width max20 mm

Fruit width min20 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min50 mm

Leaf width max30 mm

Leaf width min20 mm

Plant height8 m

Life cycle & reproduction4

Flower length max50 mm

Flower length min40 mm

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation mean1 025 m

Elevation min50 m

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malus spectabilis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPX763809.1 ↗160 115 bp

ACGT

TATATATATTTAATATTAAATTAATTAATATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGA …

Malus spectabilis isolate ROS1266 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Malus spectabilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size792 180 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Malus spectabilis0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–342n range34median34mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 345×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.

CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.

CCDB · kew — Höfer M, Meister A. 2010. Genome size variation in Malus species. Journal of Botany 2010: Article ID 480873.

2n 514×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Liang, G. l. 1986. Comparative studies of karyotypes in Chinese species of Malus. J. SouthW. Agric. Univ. (1): 104–117.

CCDB · ipcn-api-dl — Liang, G. l. & X. l. Li. 1993. Chromosome studies of Chinese species of Malus Mill. Acta Phytotax. Sin. 31: 236–251.

CCDB · kew — Höfer M, Meister A. 2010. Genome size variation in Malus species. Journal of Botany 2010: Article ID 480873.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type140 records

Wild obs. + sensor15

Museum / vouchered118

Cultivated / captive2

Other5

Origin

Native2

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 10≤1 km 3≤10 km 1

14 georeferenced · 1 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 2≤1 km 3≤10 km 3

8 georeferenced · 110 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	37
Yangling, CN	18
Xinxiang, CN	13
Paris, FR	10
Zhengzhou, CN	3
SDFlocation not on record	3
University of Stellenboschlocation not on record	2
Bronx, US	2
Guilin, CN	2
Chinese Academy of Forestrylocation not on record	2
Nanjing, CN	2
Kunming, CN	2
Auckland, NZ	2
College Park, US	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Tampa, US	1
Chongqing Museumlocation not on record	1
Long Beach, US	1
MeiseBGlocation not on record	1
Guangzhou, CN	1
Port Elizabeth Museum (Bayworld)location not on record	1
Jiangxi Universitylocation not on record	1
Dover, US	1
Rotorua, NZ	1
FJFClocation not on record	1
Burlington, US	1
Guangzhou, CN	1
Hebei Normal Universitylocation not on record	1

28 institutions · 113 of 118 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Malus spectabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)