Malus mandshurica

(Maxim.) Kom. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Malus

At a glance

Occurrence records613

Data sources11

Biological traits114

DNA specimens7

eDNA detections10

Sources11 archives

Databases and archives Malus mandshurica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility613 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources114 traits

Occurrence & distributionGBIF613 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · NCBI≈668 Mbp

01Narrative

Malus mandshurica, le Pommier de Mandchourie, est une espèce de plantes à fleurs de la famille des Rosaceae. C'est un pommier originaire d'Asie de l'Est.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTUSDATRY

Size & morphology18

Fruit length10 mm

Fruit length max12 mm

Fruit length min8 mm

Fruit width10 mm

Fruit width max12 mm

Fruit width min8 mm

Inflorescence length max8 cm

Inflorescence length min6 cm

Leaf length65 mm

Leaf length max80 mm

Leaf length min50 mm

Leaf width max40 mm

Leaf width min30 mm

Plant height15 m

⚠ sources differ — GIFT: 15 m · USDA: 6.1 m · TRY: 15 m

Plant height max30 m

Seed mass400 mg

Seed mass max400 mg

Seed mass min400 mg

Life cycle & reproduction27

Bloom periodMid Spring

Coppice potentialYes

Deciduousnessdeciduous

Flower colourwhite

Flower conspicuousYes

Flower length max35 mm

Flower length min30 mm

Flowering endJun

Flowering startJun

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDAModerate

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateNone

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment26

Active growth periodSpring and Summer

Adapted to coarse textured soilsNo

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climberself-supporting

Elevation max2 100 m

Elevation mean1 100 m

Elevation min100 m

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterModerate

Foliage textureCoarse

Fruit colourred

Growth formtree

Growth form USDAMultiple Stem

Habitat GIFTRiver valleys

Hedge toleranceMedium

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Mycorrhiza type0.00000091

Root depth min26 in

Shape and orientationRounded

Small grainNo

Woodinesswoody

Physiology & chemistry20

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredYes

Drought toleranceHigh

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min110 days

Moisture useLow

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max55 in

Precipitation min15 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceHigh

Soil pH max8 pH

Soil pH min5.2 pH

Temperature min-43 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalMedium

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound66 000 per lb

ToxicityNone

Veneer productNo

Other traits8

Fall conspicuousYes

Fruit seed abundanceHigh

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr6.1 m

Plant support typefree-standing

Planting density max1 200 per acre

Planting density min300 per acre

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malus mandshurica has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences8

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLLC694254.1 ↗599 bpJapan · 2010

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATTTTGGCAGC …

Malus mandshurica TF<JPN>:nagami014 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Malus mandshurica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈668 114 691 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Malus mandshurica0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 345×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · eflora

CCDB · iapt — IAPT/IOPB Chromosome Data 5

CCDB · ipcn-api-dl — Starodubtsev, V. N. 1984. Chromosome numbers in the species of the flora of Primorye Region. Bot. Zhurn. SSSR 69: 1565–1566. (In Russian).

CCDB · ipcn-api-dl — Liang, G. l. & X. l. Li. 1993. Chromosome studies of Chinese species of Malus Mill. Acta Phytotax. Sin. 31: 236–251.

CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type613 records

Wild obs. + sensor518

Museum / vouchered72

Cultivated / captive20

Other3

Origin

Native1

Range

Area of Occupancy AOO1 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 84≤1 km 27≤10 km 286>10 km 90

487 georeferenced · 31 without coordinates

Open the mapobservation + sensor518

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 4≤10 km 4>10 km 10

19 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence72

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy95% within 1 km

≤100 m 19≤10 km 1

20 georeferenced

Open the mapnot free-living20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	25
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	8
Siouxland Heritage Museumlocation not on record	3
东北师范大学自然博物馆location not on record	1
Nanyue Arboretumlocation not on record	1
Bronx, US	1
Philadelphia, US	1
Beijing, CN	1
Beijing, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1
Guiyang, CN	1
IWEP FEB RASlocation not on record	1

12 institutions · 45 of 72 vouchered records shown · 26 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Malus mandshurica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C -2.20–23.8

Seasonal swing summer↔winter26.4 °C

Max temp (day)17.8 °C 1.70–27.2

Min temp (night)10.3 °C -7.00–19.4

Precipitation135 mm/mo 36.6–238

Air humidity62.3 % 60.4–64.9

Moisture balance29.3 mm/mo -10.4–135

Vapour deficit586 Pa 364–1,105

Wind speed2.10 m/s 1.90–2.70

Cloud cover42.4 % 35.3–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)