Malus asiatica

Nakai · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rosaceae/Malus

At a glance

Occurrence records410

Data sources12

Biological traits28

DNA specimens6

eDNA detections6

Sources12 archives

Databases and archives Malus asiatica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility410 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionNPASS67 compounds

Occurrence & distributionGBIF410 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT · NCBI756 Mbp

01Narrative

Malus asiatica also known as the Chinese pearleaf crabapple is a species in the genus Malus, in the family Rosaceae. It is native to China and Korea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length45 mm

Fruit length max50 mm

Fruit length min40 mm

Fruit width45 mm

Fruit width max50 mm

Fruit width min40 mm

Leaf length80 mm

Leaf length max110 mm

Leaf length min50 mm

Leaf width max55 mm

Leaf width min40 mm

Plant height5 m

⚠ sources differ — GIFT: 5 m · TRY: 6 m

Plant height max6 m

Plant height min4 m

Life cycle & reproduction5

Deciduousnessdeciduous

Flower length max40 mm

Flower length min30 mm

Life formtree

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max2 800 m

Elevation mean1 425 m

Elevation min50 m

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition67 compounds

Compounds documented for Malus asiatica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Guaiane sesquiterpenoids22

Flavones9

Germacrane sesquiterpenoids9

Flavonols8

Bisabolane sesquiterpenoids6

Documented compounds67 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2S,3S,6R,7S,10R,11S)-1,6,10-trimethyl-4,14-dioxatetracyclo[9.2.1.02,10.03,7]tetradecan-5-one	present	NPASS
(1R,4S,5S)-2-methyl-5-[(2R)-6-methylhept-5-en-2-yl]cyclohex-2-ene-1,4-diol	present	NPASS
(1S,2S,4R,7E,11S,12R)-4,8,12-trimethyl-3,14-dioxatricyclo[9.3.0.02,4]tetradec-7-en-13-one	present	NPASS
(3R,3As,5aR,6R,9aS,9bS)-6-hydroxy-3,5a-dimethyl-9-methylidene-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,5aR,6R,9bS)-6-hydroxy-3,5a,9-trimethyl-3,3a,4,5,6,7,8,9b-octahydrobenzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,5aR,6R,9R,9aS,9bS)-6,9-dihydroxy-3,5a,9-trimethyl-3a,4,5,6,7,8,9a,9b-octahydro-3H-benzo[g][1]benzofuran-2-one	present	NPASS
(3R,3aS,7R,10E,11aS)-7-hydroxy-3,10-dimethyl-6-methylidene-3,3a,4,5,7,8,9,11a-octahydrocyclodeca[b]furan-2-one	present	NPASS
(3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,4,5,6,8,9b-hexahydro-6-hydroxy-3,6,9-trimethylazuleno[4,5-b]furan-2(3H)-one	present	NPASS
(3S,3aR,4S,6S,9bS)-4-(Acetyloxy)-3a,5,6,9b-tetrahydro-6-hydroxy-3,6,9-trimethyl-4H-cyclohepta(2,1-b:3,4-c')difuran-2(3H)-one	present	NPASS
(4R,6S)-4-hydroxy-3-methyl-6-[(2R)-6-methylhept-5-en-2-yl]cyclohex-2-en-1-one	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malus asiatica has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKF186578.1 ↗389 bpRussia · 2012

ACGT

TCGAACCTGCACGGCAGAACGACCCGAGAACCCGTTTCAACGTCGGGGGTCGGCGGGCCTCCTGGCCCGGCGTCCCCTTCGTCCCGGGAG …

Malus asiatica voucher VSRI:2343 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Malus asiatica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size755 505 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Malus asiatica0.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–682n range34median34mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 345×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — Darlington, Moffett 1930 altai

CCDB · book-atlas-flowering-plants — Kobel 1927

CCDB · kew — ,Korban SS, Wannarat W, Rayburn CM, Tatum TC, Rayburn AL. 2009. Genome size and nucleotypic variation in Malus germplasm. Genome 52: 148-155.

2n 681×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Liang, G. l. & X. l. Li. 1993. Chromosome studies of Chinese species of Malus Mill. Acta Phytotax. Sin. 31: 236–251.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type410 records

Wild obs. + sensor4

Museum / vouchered394

Cultivated / captive10

Other2

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 394 records without

Open the institutions mapphysical evidence394

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy17% within 1 km

≤1 km 1≤10 km 5

6 georeferenced · 4 without coordinates

Open the mapnot free-living10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	203
Yangling, CN	37
Kunming, CN	36
Chengdu, CN	18
Nanjing, CN	17
Wuhan, CN	17
Xining, CN	10
Nanjing, CN	8
Chengdu, CN	6
Lanzhou, CN	4
Wuhan, CN	4
Guiyang, CN	4
HUFDlocation not on record	3
Guangzhou, CN	3
Nanjing, CN	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
ifplocation not on record	2
Shanxi Institute of Biologylocation not on record	2
Jiangxi Universitylocation not on record	2
Nanchong, CN	1
Paris, FR	1
Xian, CN	1
Zhuzhou, CN	1
National Institute of Biological Resourceslocation not on record	1
Central China Normal Universitylocation not on record	1
Tokushima, JP	1
WNNUlocation not on record	1
Nagano City, JP	1
湖北神农架林区标本馆location not on record	1
Edinburgh, GB	1

30 institutions · 392 of 394 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Malus asiatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)