Malpighia glabra
speciesAt a glance
Occurrence records4 564
Data sources13
Biological traits33
DNA specimens38
eDNA detections20
Sources13 archives
Databases and archives Malpighia glabra's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 564 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources33 traits
Chemical compositionLOTUS12 compounds
Occurrence & distributionGBIF4 564 records
Environmental DNA1 datasets · 4 countries20 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB2n = 20
01Narrative
L'acerola è una pianta della famiglia Malpighiaceae che cresce spontanea in America centrale e meridionale
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Plant height6 m
⚠ sources differ — GIFT: 6 m · TRY: 4 m
Plant height max4 m
Seed mass22.93 mg
Seed mass max22.93 mg
Seed mass min22.93 mg
Life cycle & reproduction7
Deciduousnessevergreen
Dispersal typeanimal
Life formshrub or tree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 100 m
Elevation min0 m
Epiphyteterrestrial
Growth formshrub
Habitat GIFTforest
Woodinesswoody
Physiology & chemistry9
Ldmc max358 mg/g
Ldmc min358 mg/g
Leaf C:N ratio27.81 g/g
Leaf dry-matter content (LDMC)293 mg/g
⚠ sources differ — TRY: 293 mg/g · GIFT: 358 mg/g
Nitrogen fixingnon_nitrogen_fixer
Specific leaf area (SLA)23.99 mm²/mg
⚠ sources differ — TRY: 23.99 mm²/mg · GIFT: 14.46 mm²/mg
Wood density640 mg/cm³
⚠ sources differ — TRY: 640 mg/cm³ · GIFT: 710 mg/cm³
Wood density max710 mg/cm³
Wood density min710 mg/cm³
Other traits2
Sla max11.56 mm²/mg
Sla min11.56 mm²/mg
03Chemical composition12 compounds
Compounds documented for Malpighia glabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Fatty alcohols3
Wax monoesters3
Oxygenated hydrocarbons2
Menthane monoterpenoids $ Monocyclic monoterpenoids1
Stigmastane steroids1
Documented compounds12 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 1-Octadecanol | present | LOTUS | |
| 2-Pentanone | present | LOTUS | |
| 3-Octen-1-ol | present | LOTUS | |
| Acetoin | present | LOTUS | |
| Acetophenone | present | LOTUS | |
| beta-Sitosterol | present | LOTUS | |
| Ethyl hexanoate | present | LOTUS | |
| Hexyl butyrate | present | LOTUS | |
| L-Ascorbic acid | present | LOTUS | |
| Limonene | present | LOTUS |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malpighia glabra has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections20
Countries4
The DNA barcodea real sequence read deposited for this species
AGTGTTGGATTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …
Malpighia glabra voucher BioBot11189 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL7★rbcLa★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Malpighia glabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–402n range20median20mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 205×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-indian_vol1 +1
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.
CCDB · book-ipcn66 — Fouet1966
CCDB · book-indian_vol1 — Bawa, K.S. 1973
CCDB · book-indian_vol1 — Raman, V.S. & Kesavan, P.C. 1963b
CCDB · book-fedorov — Raman, Kesavan 1963b
2n 402×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Pal, M. 1964; Sarkar, A.K., Datta, N. & Chatterjee, U. 1980
CCDB · book-fedorov — Pal M. 1964
n 103×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Cave1963
CCDB · ipcn-api-dl — Anderson, W.R. 1993. Chromosome numbers of neotropical Malpighiaceae. Contr. Univ. Michigan Herb. 19: 341–354.
CCDB · book-ipcn73-74 — BAWA, K.S. 1973. Chromosome numbers of tree species of a lowland tropical community. J. Arnold Arbor. 54: 422-434.
CCDB · Cave1963 — Raman & Kes. 1963b
n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Pandey, R. M. & M. Pal. 1980a. In Chromosome number reports LXVIII. Taxon 29: 544–545.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 564 records
Wild obs. + sensor1 648
Museum / vouchered2 891
Cultivated / captive24
Other1
Origin
Native5
Introduced4
Range
Area of Occupancy AOO8 176 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 528≤1 km 150≤10 km 40>10 km 55
773 georeferenced · 875 without coordinates
Open the mapobservation + sensor1 648
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy92% within 1 km
≤100 m 999≤1 km 70≤10 km 72>10 km 26
1 167 georeferenced · 1 724 without coordinates
Open the institutions mapphysical evidence2 891
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy92% within 1 km
≤100 m 11≤10 km 1
12 georeferenced · 12 without coordinates
Open the mapnot free-living24
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions66 of 156 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 519 |
| Saint Louis, US | 398 |
| Mexico City, MX | 249 |
| Ann Arbor, US | 187 |
| National Biodiversity Institute, Costa Ricalocation not on record | 112 |
| Mexico City, MX | 103 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 69 |
| Austin, US | 66 |
| Mérida, MX | 66 |
| Antiguo Cuscatlán, SV | 63 |
| San Francisco, US | 49 |
| Tapachula, MX | 49 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 42 |
| Berlin, DE | 40 |
| San Francisco de Campeche, MX | 40 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 38 |
| MEXUlocation not on record | 33 |
| Bronx, US | 32 |
| Chicago, US | 28 |
| San José, CR | 27 |
| Chapingo, MX | 27 |
| León, NI | 25 |
| Tuxtla Gutiérrez, MX | 24 |
| Tuxtla Gutiérrez, MX | 23 |
| Juriquilla, MX | 21 |
| Austin, US | 19 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 18 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 17 |
| Universidad de Antioquia (UdeA)location not on record | 17 |
| Universidad Nacional de Colombia (UNAL)location not on record | 16 |
| University of Stellenboschlocation not on record | 16 |
| Kew, GB | 14 |
| ASUlocation not on record | 13 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 13 |
| Mexico City, MX | 13 |
| Riverside, US | 13 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 13 |
| Taipei, TW | 12 |
| Universidad de Nariño (UdeNar)location not on record | 11 |
| Tampa, US | 11 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 10 |
| UNIVASFlocation not on record | 9 |
| BMlocation not on record | 8 |
| Guatemala City, GT | 8 |
| Laboratorio de Ictiologialocation not on record | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| UNEMATlocation not on record | 7 |
| Universidad del Valle (UV)location not on record | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| CASlocation not on record | 6 |
| Salvador, BR | 6 |
| UFPIlocation not on record | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| Ilhéus, BR | 5 |
| Edinburgh, GB | 5 |
| UEPAlocation not on record | 5 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 5 |
| Uberlândia, BR | 5 |
| Cambridge, US | 4 |
| INBIOlocation not on record | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| MAlocation not on record | 4 |
| UEMAlocation not on record | 4 |
| South Kensington, GB | 4 |
| HEMlocation not on record | 4 |
| University of Zhejianglocation not on record | 4 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Culiacán, MX | 3 |
| Feira de Santana, BR | 3 |
| HUENFlocation not on record | 3 |
| UFVJMlocation not on record | 3 |
| Santiago de Cali, CO | 3 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Paris, FR | 2 |
| UFBAlocation not on record | 2 |
| UnBlocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| NO DISPONIBLElocation not on record | 2 |
| UFOPlocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Cascavel, BR | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| Davis, US | 2 |
| Montréal, CA | 2 |
| Cambridge, US | 2 |
| Ivano-Frankivsk, UA | 2 |
| JBRJlocation not on record | 2 |
| Altos de Pipe, VE | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Masindi, UG | 2 |
| Museo de Historia Natural de El Salvadorlocation not on record | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Mlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Pondicherry, IN | 1 |
| Vancouver, CA | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Glocation not on record | 1 |
| Jardín Botánico de Cartagena “Guillermo Piñeres”location not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| CHAPAlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Calabar, NG | 1 |
| Durham, US | 1 |
| UEMlocation not on record | 1 |
| Loja, EC | 1 |
| Wlocation not on record | 1 |
| Durban, ZA | 1 |
| Taipei, TW | 1 |
| Alexandria Universitylocation not on record | 1 |
| Universidad de Autonoma de Baja Californialocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Maringá, BR | 1 |
| Mérida, MX | 1 |
| Ciudad de México, MX | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Instituto de invertigación de recursos biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| CPATSAlocation not on record | 1 |
| San Luis Potosí, MX | 1 |
| USP-IBlocation not on record | 1 |
| Claremont, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Fortaleza, BR | 1 |
| Kensington, AU | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Monastir, TN | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Université de Bordeauxlocation not on record | 1 |
| San Diego, US | 1 |
| Wuzhou, CN | 1 |
| OTSlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| HUAlocation not on record | 1 |
| Miami, US | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| IANIGLAlocation not on record | 1 |
| Los Angeles, US | 1 |
| Chaguaramas, TT | 1 |
| UNESP-ISlocation not on record | 1 |
| QCNElocation not on record | 1 |
156 institutions · 2 831 of 2 891 vouchered records shown · 60 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Malpighia glabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.7 °C 18.2–26.7
Seasonal swing summer↔winter5.50 °C
Max temp (day)27.7 °C 25.6–31.0
Min temp (night)21.9 °C 12.2–24.1
Precipitation148 mm/mo 9.00–313
Air humidity63.9 % 51.6–69.9
Moisture balance9.90 mm/mo -66.4–166
Vapour deficit1,007 Pa 950–1,228
Wind speed2.00 m/s 1.50–2.90
Cloud cover28.4 % 26.4–46.2
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.