Malosma laurina

(Nutt. ex Torr. & A.Gray) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Anacardiaceae/Malosma

At a glance

Occurrence records17 733

Data sources9

Biological traits17

DNA specimens6

eDNA detections3

Sources9 archives

Databases and archives Malosma laurina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 733 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF17 733 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Malosma laurina in bloom. The bumblebee on the right side of the flower cluster (and near its middle) sets the scale of the photograph. Malosma is a plant genus which contains only a single species, Malosma laurina, with the common names laurel sumac and lentisco (Spanish).Integrated Taxonomic Information System (2007). Malosma, retrieved June 10, 2007. Malosma laurina is found along the southern California and Baja California coasts of the Pacific Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height4.88 m

⚠ sources differ — GIFT: 4.88 m · TRY: 3.85 m

Seed mass3.21 mg

⚠ sources differ — TRY: 3.21 mg · GIFT: 65.45 mg

Seed mass max312 mg

Seed mass min2.8 mg

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: S

Woodinesswoody

Physiology & chemistry3

Photosynthetic pathwayC3

Specific leaf area (SLA)4.83 mm²/mg

Wood density471 mg/cm³

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malosma laurina has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF963983.1 ↗704 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAATCTGTTACAAACG …

Malosma laurina isolate CBP274 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type17 733 records

Wild obs. + sensor17 626

Museum / vouchered107

Range

Area of Occupancy AOO9 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 11 744≤1 km 1 462≤10 km 575>10 km 226

14 007 georeferenced · 3 619 without coordinates

Open the mapobservation + sensor17 626

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 2≤1 km 47≤10 km 22>10 km 5

76 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	57
San Luis Obispo, US	16
Saint Louis, US	5
Long Beach, US	5
Flagstaff, US	4
Phoenix, US	4
Wuzhou, CN	2
EL PASO, US	2
Bloomington, US	2
Fort Worth, US	2
Severin-McDaniel Insect Collectionlocation not on record	2
Mississippi State, US	1
US	1
San Diego Natural History Museumlocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Claremont, US	1
AUAlocation not on record	1

17 institutions · 107 of 107 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Malosma laurina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Coastal Sage Scrub with Artemisia californic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.0 °C 15.0–15.0

Seasonal swing summer↔winter10.9 °C

Max temp (day)20.2 °C

Min temp (night)10.5 °C

Precipitation19.9 mm/mo

Air humidity60.9 %

Moisture balance-100 mm/mo

Vapour deficit667 Pa

Wind speed2.30 m/s

Cloud cover31.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Malosma laurina

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction4

Diet & foraging1

Habitat & environment5

Physiology & chemistry3

At a glance

Record type17 733 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 733 records