Mallotus mollissimus

(Geiseler) Airy Shaw · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Mallotus

At a glance

Occurrence records1 068

Data sources7

Biological traits39

DNA specimens12

eDNA detections8

Sources7 archives

Databases and archives Mallotus mollissimus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 068 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Occurrence & distributionGBIF1 068 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Tutup beling adalah sejenis pohon penyusun hutan sekunder, anggota suku Euphorbiaceae. Sebagaimana jenis-jenis balik angin yang lain, sisi bawah daun M. mollissimus juga berwarna keputih-putihan dan tampak berkilauan manakala tertiup angin; yang menjadi asal-usul namanya. Nama-nama lokalnya, di antaranya, kayu sibalik-angin (Sum.); calik angin (Sd.); tutup beling (Jw.); kayu wollo sola, laransiana urune, lemoro, ota-ota (Slw.); bekwaap, bie grai, majetrip (Hattam); mangafafin (Biak) di Papua. Dalam bahasa Inggris dikenal sebagai Green Kamala, Soft Kamala, Woolly Mallotus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length6.5 mm

Fruit width7.5 mm

Leaf length172 mm

Leaf mass per area63 g/m2

Leaf size30 858 mm²

Leaf width136 mm

Plant height10 m

⚠ sources differ — AusTraits: 10 m · TRY: 7.61 m

Seed length4 mm

Seed mass7.27 mg

⚠ sources differ — TRY: 7.27 mg · AusTraits: 22 mg · GIFT: 7.27 mg

Seed mass max7.27 mg

Seed mass min7.27 mg

Seed volume14 mm³

Seed volume max14 mm³

Seed volume min14 mm³

Seed width4 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyyyyyynnnnnn

Life formshrub or tree

Life spanperennial

Pollination syndromewind

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: tree · TRY: Tree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry6

Leaf n37.8 mg/g

Leaf p3.7 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)17.22 mm²/mg

Wood density443 mg/cm³

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mallotus mollissimus has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes6

GenBank sequences5

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF361109.1 ↗628 bp

ACGT

TCAAAACCTGCTCTGCAGAATGACCCGCGAACACGTTTACAATACCTAAGTGGAGCGGGGGGCTTATGCTCCCTAGACCCACTAATGCTG …

Mallotus mollissimus internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 068 records

Wild obs. + sensor29

Museum / vouchered950

Cultivated / captive2

Other87

Origin

Native16

Range

Area of Occupancy AOO2 416 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 12≤1 km 5>10 km 1

18 georeferenced · 11 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 31≤1 km 25≤10 km 131>10 km 33

220 georeferenced · 730 without coordinates

Open the institutions mapphysical evidence950

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	93
Smithfield, AU	91
Kew, GB	38
Museo Entomologico de Leonlocation not on record	32
Canberra, AU	22
Mount Annan, AU	15
University of Stellenboschlocation not on record	9
Bronx, US	6
Palmerston, AU	6
Armidale, AU	6
Honolulu, US	6
Llocation not on record	5
BISHlocation not on record	5
Saint Louis, US	5
South Kensington, GB	4
Cibinong Science Center, Herbarium Bogorienselocation not on record	4
Edinburgh, GB	4
Fort Worth, US	3
Cibinong, ID	3
James Cook Townsvillelocation not on record	2
BMlocation not on record	2
Auckland, NZ	2
Uniwersytet Wrocławskilocation not on record	2
Adelaide, AU	2
Xiamen, CN	1
Australian Tropical Herbariumlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
MeiseBGlocation not on record	1
Moscow State Universitylocation not on record	1
St. Paul, US	1
ASUlocation not on record	1
Zürich, CH	1
CASlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

34 institutions · 377 of 950 vouchered records shown · 572 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Mallotus mollissimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.9 °C 20.8–25.1

Seasonal swing summer↔winter4.20 °C

Max temp (day)27.5 °C 25.8–28.4

Min temp (night)20.7 °C 15.0–22.5

Precipitation165 mm/mo 44.7–277

Air humidity68.9 % 50.8–70.3

Moisture balance0.7 mm/mo -91.0–133

Vapour deficit957 Pa 904–1,294

Wind speed1.90 m/s 1.20–3.30

Cloud cover56.8 % 22.6–62.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Mallotus mollissimus

At a glance

Sources7 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry6

At a glance

Record type1 068 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 068 records