Mallotus megadontus

P.I.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Mallotus

At a glance

Occurrence records203

Data sources7

Biological traits18

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Mallotus megadontus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF203 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Mallotus megadontus is an Australian rainforest tree in the spurge family. It is known as the toothed mallotus and is native to South East Queensland. It is listed as vulnerable.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology5

Leaf length90 mm

Leaf width43.5 mm

Plant height2 m

Seed length3.5 mm

Seed width2.5 mm

Life cycle & reproduction4

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mallotus megadontus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM895830.1 ↗512 bpAustralia

ACGT

AATATTATACTCCTGAATATGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAGGAAG …

Mallotus megadontus voucher 1076418250 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor142

Museum / vouchered58

Other3

Origin

Native2

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 74≤1 km 15≤10 km 3

92 georeferenced · 50 without coordinates

Open the mapobservation + sensor142

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 37≤1 km 2≤10 km 6>10 km 3

48 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	44
Museo Entomologico de Leonlocation not on record	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Mount Annan, AU	1
Armidale, AU	1
Honolulu, US	1
BISHlocation not on record	1

7 institutions · 52 of 58 vouchered records shown · 6 without an institution code

09Environmental DNA2 detections

Where the DNA of Mallotus megadontus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 19.4–19.4

Seasonal swing summer↔winter10.3 °C

Max temp (day)23.7 °C

Min temp (night)15.7 °C

Precipitation132 mm/mo

Air humidity60.5 %

Moisture balance17.2 mm/mo

Vapour deficit895 Pa

Wind speed2.10 m/s

Cloud cover25.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)