Mallotus discolor

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Mallotus

At a glance

Occurrence records807

Data sources10

Biological traits37

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Mallotus discolor's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility807 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF807 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Mallotus discolor is an Australian rainforest tree in the spurge family. It is known as the yellow kamala, due to the yellowish orange fruit covering, which produces a yellow dye.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology14

Fruit length6.5 mm

Fruit width8 mm

Leaf length70 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf width32.5 mm

Leaf width max40 mm

Leaf width min25 mm

Petiole length4 cm

Plant height10 m

⚠ sources differ — GIFT: 10 m · AusTraits: 30 m

Plant height max15 m

Seed length3.5 mm

Seed mass10.62 mg

Seed width2.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscencedehiscent

Flowering timeynnnnnnnyyyy

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate ovate triangular

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density633 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Mallotus discolor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Methyl xanthones $ Plant xanthones2

Flavones2

Isoflavones1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
18-Hydroxyoctadeca-9,11,13-trienoic acid	present	LOTUS
3,8-Dihydroxy-4,6-dimethoxy-9-oxo-9H-xanthene-1-carboxylic acid methyl ester	present	NPASS
8-Carboxymethyl-1,3,5,6-tetrahydroxyxanthone	present	NPASS
alpha-Kamlolenic acid	present	LOTUS
Apigenin	present	NPASS
Luteolin 7-diglucoside	present	NPASS
Vavain	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mallotus discolor has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes6

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ866597.1 ↗696 bp

ACGT

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCTGCAGAACGACCCGCGAACATGTTTACAACACCTAGGTGGAGAG …

Mallotus discolor 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type807 records

Wild obs. + sensor442

Museum / vouchered177

Cultivated / captive3

Other185

Origin

Native35

Range

Area of Occupancy AOO1 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 284≤1 km 54≤10 km 14>10 km 13

365 georeferenced · 77 without coordinates

Open the mapobservation + sensor442

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 37≤1 km 13≤10 km 83>10 km 15

148 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence177

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	75
Mount Annan, AU	34
Museo Entomologico de Leonlocation not on record	17
Armidale, AU	14
Canberra, AU	10
Smithfield, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	2
James Cook Townsvillelocation not on record	1
Wollongong, AU	1
Hobart, AU	1
Claremont, US	1
Adelaide, AU	1
Saint Louis, US	1
Palmerston, AU	1

14 institutions · 168 of 177 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Mallotus discolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)