Malesherbia linearifolia

(Cav.) Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Malesherbiaceae/Malesherbia

At a glance

Occurrence records331

Data sources8

Biological traits14

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Malesherbia linearifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility331 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF331 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Malesherbia linearifolia est une espèce de plantes à fleurs de la famille des Malesherbiaceae, selon la classification classique, de la famille des Passifloraceae, selon la classification phylogénétique. Son nom vernaculaire est « Blue Star of Cordillera ». Il est originaire de Coquimbo, Valparaiso, Metropolitana et de la région d'O'Higgins du Chili.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.37 mg

⚠ sources differ — TRY: 1.37 mg · GIFT: 1.28 mg

Seed mass max1.6 mg

Seed mass min0.85 mg

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 200 m

Elevation min400 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Malesherbia linearifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cyanogenic glycosides2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(1S)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycyclopent-2-ene-1-carbonitrile		present	LOTUS
Tetraphyllin B		present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malesherbia linearifolia has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections9

The DNA barcodea real sequence read deposited for this species

ITSAF276379.1 ↗208 bp

ACGT

ATCGTCGCCCCCACACCCCATTACGGGAATTGCTGGGGCGGACATTGGCCTCCCGTGTGCTCCCGCTTGCGGCTGGCCGAAATGAGAGTT …

Malesherbia linearifolia KMG36 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type331 records

Wild obs. + sensor294

Museum / vouchered37

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 160≤1 km 44≤10 km 22>10 km 16

242 georeferenced · 52 without coordinates

Open the mapobservation + sensor294

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	16
Chicago, US	13
Nunoa, Santiago, CL	3
MAlocation not on record	2
Xiamen, CN	1
Auckland, NZ	1
Uppsala, SE	1

7 institutions · 37 of 37 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Malesherbia linearifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)