Malassezia restricta

E.Guého, J.Guillot & Midgley · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Malasseziomycetes/Malasseziales/Malasseziaceae/Malassezia

At a glance

Occurrence records1 353

Data sources6

Biological traits0

DNA specimens28

eDNA detections6 525

Sources6 archives

Databases and archives Malassezia restricta's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 525 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

NCBIUS National Library of Medicinesequences↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 353 records

Environmental DNA19 datasets · 60 countries6 525 detections

DNA & barcodingBOLD · NCBI28 specimens

Genome at a glanceGoaT · NCBI≈7 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malassezia restricta has left across the world's sequence archives.

At a glance

DNA specimens28

Marker genes6

GenBank sequences9

eDNA detections6 525

Countries60

The DNA barcodea real sequence read deposited for this species

ITSPX570796.1 ↗279 bpPoland · 2024

ACGT

TTACCAATATCAGCCTGCCGGCTGCCGCGGTGGTTGTTAAGTCAACCGCACGGTTTTCCGGTCAGGTGAACCAGTACGACCTGTGCTTTG …

Malassezia restricta clone SH1515577.08FU_KR185803 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS9★ITS1★ITS228S-D1-D25-8S

animal barcodefungal barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_039455 ↗ · 16 protein · 24 tRNA · 2 rRNA

cobnad2nad3cox3nad6cox2nad1nad4Lnad5atp9batp9anad4atp6cox1atp8rps3large subunit ribosomal RNAsmall subunit ribosomal RNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Malassezia restricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈7 330 907 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Malassezia restricta0.0073 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness85.8% BUSCO

08Occurrence & distribution

Record type1 353 records

Wild obs. + sensor2

Museum / vouchered1 349

Cultivated / captive2

Range

Area of Occupancy AOO2 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 347 without coordinates

Open the institutions mapphysical evidence1 349

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	49
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
TNMlocation not on record	1

3 institutions · 51 of 1 349 vouchered records shown · 1 293 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 525 detections

Where the DNA of Malassezia restricta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6 525

Studies independent surveys19

Countries60

Verifiable raw sequence linked51

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 525 detections have coordinates

Open the map60 countries0

humanTreed pine-dwarfshrubs-sphagnum ombrotrophic…Birch(Hardwood) dowel buried in soil of a co…AfrotropicNeotropicNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.0 °C 8.00–40.0

pH6.10 3.40–10.0

Conductivity64.1 µS/cm 10.0–164,500

Salinity34.1 PSU 14.6–36.8

Dissolved oxygen7.99 mg/L 5.36–10.0

Turbidity0.492 NTU 0–5.12

Organic carbon0.84 % 0.004–16.3

Water content7.61 % 0–103

Nitrate-N5.00 mg/kg 0.145–284

Nitrate7.05 µmol/L 0.9–9.10

Phosphorus12.0 mg/kg 1.00–1,130

Clay12.6 % 0.91–75.9

Sand74.3 % 1.00–99.9

Depth0 m 0–100

SoilPelagicSedimentCoralCoastal waterMarinePodosolVertosolsVertosolCalcarosolTenosolKurosol

1 059 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 9.90–28.6

Seasonal swing summer↔winter13.1 °C

Max temp (day)18.8 °C 13.2–32.8

Min temp (night)15.0 °C 6.20–25.0

Precipitation78.0 mm/mo 32.4–157

Air humidity60.9 % 54.6–66.1

Moisture balance19.1 mm/mo

Vapour deficit748 Pa 414–1,621

Wind speed4.00 m/s

Cloud cover39.4 % 19.1–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 421 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Malassezia restricta

At a glance

Sources6 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 353 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 353 records