Malassezia globosa

Midgley, E.Guého & J.Guillot · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Malasseziomycetes/Malasseziales/Malasseziaceae/Malassezia

At a glance

Occurrence records2 175

Data sources7

Biological traits0

DNA specimens22

eDNA detections3 062

Sources7 archives

Databases and archives Malassezia globosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 062 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 175 records

Environmental DNA18 datasets · 50 countries3 062 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceGoaT · NCBI9 Mbp

01Narrative

Malassezia globosa est une espèce de champignons unicellulaires ovales. C’est l’un des champignons responsables de la maladie cutanée Pityriasis versicolor chez l’homme et certains animaux. Elle fait partie des 8 espèces du genre Malassezia recensées dans la flore commensale de l’homme. Celle-ci est lipophile et se développe principalement l’été, en présence de sueur.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Malassezia globosa has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes6

GenBank sequences8

eDNA detections3 062

Countries50

The DNA barcodea real sequence read deposited for this species

ITSPV627473.1 ↗328 bpAustralia · 2023

ACGT

AAGTCGTAACAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTAGTGAAGATTCAAGGGCCAGCCATACAGACGTACAATAAGTGTGT …

Malassezia globosa isolate OTU_605 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS8★ITS1★ITS228S-D1-D25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Malassezia globosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size8 950 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Malassezia globosa0.0089 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness91.8% BUSCO

08Occurrence & distribution

Record type2 175 records

Wild obs. + sensor3

Museum / vouchered2 154

Cultivated / captive18

Range

Area of Occupancy AOO1 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4

4 georeferenced · 2 150 without coordinates

Open the institutions mapphysical evidence2 154

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Stockholm, SE	15
BioPlatformslocation not on record	3
UAclocation not on record	1

3 institutions · 19 of 2 154 vouchered records shown · 2 133 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 062 detections

Where the DNA of Malassezia globosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3 062

Studies independent surveys18

Countries50

Verifiable raw sequence linked16

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 062 detections have coordinates

Open the map50 countries0

headSpruce(Softwood) dowel buried in soil of a c…humanTreed pine-dwarfshrubs-sphagnum ombrotrophic…Pine(Softwood) dowel buried in soil of a mix…Australasia

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.7 °C 0–32.0

pH7.08 3.60–9.70

Conductivity45,565 µS/cm 6.00–91,900

Salinity35.3 PSU 5.86–37.0

Dissolved oxygen7.17 mg/L 1.99–12.4

Turbidity0.327 NTU 0–19.6

Organic carbon0.48 % 0.003–9.72

Water content8.45 % 0.236–88.1

Nitrate-N8.00 mg/kg 0.023–150

Nitrate0.765 µmol/L 0.005–19.0

Phosphorus19.8 mg/kg 2.00–1,077

Clay12.9 % 0.93–67.0

Sand73.1 % 3.00–99.2

Depth2.00 m 0–6,015

SoilPelagicSedimentCoastal waterMarineTenosolVertosolChromosolHydrosolKurosolPodosol

1 728 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 9.70–25.7

Seasonal swing summer↔winter7.00 °C

Max temp (day)20.2 °C 13.2–28.0

Min temp (night)16.1 °C 6.10–23.9

Precipitation84.5 mm/mo 31.4–283

Air humidity59.1 % 55.4–66.4

Vapour deficit831 Pa 449–1,296

Cloud cover27.7 % 16.5–52.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 011 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Malassezia globosa

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 175 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions1 of 3 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 175 records