Magicicada tredecim

(Riley, 1868) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadidae/Magicicada

At a glance

Occurrence records2 421

Data sources7

Biological traits0

DNA specimens36

eDNA detections36

Sources7 archives

Databases and archives Magicicada tredecim's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 421 records

Environmental DNA1 datasets · 1 countries36 detections

DNA & barcodingBOLD36 specimens

01Narrative

Magicicada tredecim is a 13-year species of periodical cicada, closely related to the newly discovered 13-year species Magicicada neotredecim, from which it differs in male song pitch, female song pitch preferences, abdomen color, and mitochondrial DNA. Both M. tredecim and M. neotredecim are closely related to the 17-year species M. septendecim, which was identified by Linnaeus in 1758; these three species are often grouped together under the name decim periodical cicadas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Magicicada tredecim has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections36

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P1 536 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.07%

Where individuals differ — all 1 variable positions, in barcode order

933Cmostly conserved

ATGAATAAGTGATTTTTCTCAACTAATCATAAAGATATTGGAACGTTATATTTCATTTTCGGGATTTGATCAGGGATAGTAGGTACAACT …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_041652 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn1612SrRNA

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 421 records

Wild obs. + sensor1 955

Museum / vouchered466

Range

Area of Occupancy AOO4 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 1 001≤1 km 236≤10 km 81>10 km 248

1 566 georeferenced · 389 without coordinates

Open the mapobservation + sensor1 955

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 4≤1 km 2≤10 km 8>10 km 5

19 georeferenced · 447 without coordinates

Open the institutions mapphysical evidence466

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	401
Champaign, US	37
US	7
College Station, US	6
Wuzhou, CN	5
Colorado State Universitylocation not on record	3
East Lansing, US	2
University of Central Floridalocation not on record	2

8 institutions · 463 of 466 vouchered records shown · 2 without an institution code

09Environmental DNA36 detections

Where the DNA of Magicicada tredecim was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-1.30 °C -1.30–-0.2

Seasonal swing summer↔winter27.0 °C

Max temp (day)4.60 °C 4.60–4.80

Min temp (night)-5.00 °C -5.00–-3.80

Precipitation20.9 mm/mo 20.9–57.7

Air humidity58.8 %

Moisture balance-19.7 mm/mo

Vapour deficit234 Pa 234–257

Wind speed5.80 m/s 4.30–5.80

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Magicicada tredecim

At a glance

Sources7 archives

At a glance

Record type2 421 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 421 records