Magallana angulata

(Lamarck, 1819) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Ostreida/Ostreidae/Magallana

At a glance

Occurrence records230

Data sources8

Biological traits5

DNA specimens368

eDNA detections5

Sources8 archives

Databases and archives Magallana angulata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility214 records↗

OBISOcean Biodiversity Information System16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics368 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS230 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD368 specimens

Genome at a glanceGoaT · NCBI≈624 Mbp

01Narrative

Magallana angulata, l’huître portugaise, est une espèce d’huîtres d'origine asiatique. Probablement introduite au XVIIe siècle au Portugal, elle a été cultivée en Europe à la fin du XIXe siècle. Après une épizootie due à un iridovirus, Crassostrea angulata a presque disparu à la fin des années 1960 et l'espèce a été remplacée par Crassostrea gigas

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max7 m

Depth min0 m

05DNA & barcoding368 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Magallana angulata has left across the world's sequence archives.

At a glance

DNA specimens368

BINs3

Marker genes12

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P603 bp consensus348 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

80Cmostly conserved

185Gmostly conserved

308Avariable

332Tmostly conserved

353Cmostly conserved

356Amostly conserved

476Cmostly conserved

TTTGAGCTGTTCTTGCGGGAACTAGGTTTAGGTCTCTTATTCGTTGGAGGCTTTATAACCCCGGAGCTAAGTTTTTAGACCCCGTGACTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 61 variants.

Diversity (π)0.56%

Haplotypes61

BINs3

Most divergent pair1.3%

AsiaEuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Magallana gigassame genus2.4%Magallana sikameasame genus9.2%Magallana saidiisame genus13.3%Magallana ariakensissame genus14.5%Magallana gryphoidessame genus14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS1COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_012648 ↗ · 12 protein · 25 tRNA · 4 rRNA

COX1COX3CYTBCOX2ATP6ND2ND4ND5ND6ND3ND1ND4Ll-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Magallana angulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈624 273 838 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Magallana angulata0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type230 records

Wild obs. + sensor130

Museum / vouchered86

Other14

Range

Area of Occupancy AOO432 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6.5 m · max 6.5 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 14≤1 km 32≤10 km 48

94 georeferenced · 36 without coordinates

Open the mapobservation + sensor130

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 2≤10 km 2>10 km 6

10 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	2
Paleontological Research Institutionlocation not on record	2
RBINS-Scientific Heritagelocation not on record	2
730location not on record	1

4 institutions · 7 of 86 vouchered records shown · 71 without an institution code

09Environmental DNA5 detections

Where the DNA of Magallana angulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 13.4–13.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)18.2 °C

Min temp (night)8.10 °C

Precipitation75.4 mm/mo

Air humidity57.8 %

Moisture balance-30.7 mm/mo

Vapour deficit649 Pa

Wind speed3.10 m/s

Cloud cover39.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)