Maera danae

(Stimpson, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Maeridae/Maera

At a glance

Occurrence records206

Data sources8

Biological traits2

DNA specimens20

eDNA detections90

Sources8 archives

Databases and archives Maera danae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

OBISOcean Biodiversity Information System78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI90 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS206 records

Environmental DNA2 datasets · 1 countries90 detections

DNA & barcodingBOLD20 specimens

01Narrative

Maera danae is a species of crustacean in the genus Maera. It is found in the Western Atlantic Ocean off the coast of Eastern Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Maera danae has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections90

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

15Gmostly conserved

42Cmostly conserved

123Cmostly conserved

198Cmostly conserved

216Cmostly conserved

231Tmostly conserved

276Amostly conserved

346Gmostly conserved

369Tmostly conserved

411Gmostly conserved

579Gmostly conserved

624Cmostly conserved

TTGTATTTGATCTTGGGCCTTTGATCAGGAATGCTAGGGGCCTCCCTTAGAATAATTGTTCGGTCCGAATTGACCACTCCAGGTAGCTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes6

BINs2

Most divergent pair2.3%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type206 records

Wild obs. + sensor55

Museum / vouchered149

Other2

Range

Area of Occupancy AOO416 km²

Depth

0–200 m sunlit56

200–1000 m twilight4

1–4 km midnight0

>4 km abyssal0

median 45.6 m · max 220 m · 60 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2≤1 km 7≤10 km 1

10 georeferenced · 45 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 24≤1 km 8≤10 km 7>10 km 1

40 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Los Angeles, US	12
Washington, US	10
Edmonton, CA	8
New Haven, US	7
Mexico City, MX	4
The Atlantic reference Centrelocation not on record	4
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
CASlocation not on record	2
Santa Barbara Museum of Natural Historylocation not on record	1
Cambridge, US	1
Toronto, CA	1
Saint John, CA	1
Maurice Lamontagne Institutelocation not on record	1

16 institutions · 90 of 149 vouchered records shown · 20 without an institution code

09Environmental DNA90 detections

Where the DNA of Maera danae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found90

Studies independent surveys2

Countries1

Verifiable raw sequence linked72

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 90 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 8.90–19.1

Seasonal swing summer↔winter23.4 °C

Max temp (day)21.1 °C 12.1–23.3

Min temp (night)14.6 °C 6.40–16.4

Precipitation98.6 mm/mo 89.1–127

Air humidity63.2 % 61.5–65.0

Moisture balance-11.5 mm/mo -43.9–81.6

Vapour deficit689 Pa 435–826

Wind speed2.00 m/s 1.80–3.80

Cloud cover51.5 % 51.1–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 90 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)