Madremyia saundersii

(Williston, 1889) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Madremyia

At a glance

Occurrence records24

Data sources9

Biological traits0

DNA specimens56

eDNA detections51

Sources9 archives

Databases and archives Madremyia saundersii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 2 countries51 detections

DNA & barcodingBOLD56 specimens

Genome at a glanceGoaT · TreeOfSex2n = 12

01Narrative

Madremyia saundersii is a species of bristle fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Madremyia saundersii has left across the world's sequence archives.

At a glance

DNA specimens56

BINs1

Marker genes2

eDNA detections51

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

138Amostly conserved

171Tmostly conserved

345Gmostly conserved

411Tmostly conserved

603Cmostly conserved

630Tmostly conserved

ACTCTTTATTTCATTTTTGGAGCTTGATCAAGAATAATTGGAACTTCTTTAAGTATACTAATTCGAATAGAATTAGGCCATACAGGTTCA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.64%

Haplotypes8

BIN1

Most divergent pair1.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tsugaea noxsame family5.3%Phryxe vulgarissame family5.5%Phryxe pecosensissame family5.6%Phryxe nemeasame family5.7%Phryxe erythrostomasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S-D2

animal barcodemarker

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Madremyia saundersii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1210×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Boyes, J. and A. Wilkes (1953). "Somatic Chromosomes of Higher Diptera: I. Differentiation of Tachinid Parasites." Canadian Journal of Zoology 31(2): 125-165. ↗

TreeOfSex · invert — Boyes, J. and J. M. Van Brink (1965). "Chromosomes of Calyptrate Diptera." Canadian Journal of Genetics and Cytology 7(4): 537-550. ↗

TreeOfSex · invert — Jan, K. (1967). Cytotaxonomical Studies of Some Schizophorous Diptera. Master of Science, McGill University. ↗

08Occurrence & distribution

Record type24 records

Museum / vouchered24

Range

Area of Occupancy AOO60 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
Royal Saskatchewan Museumlocation not on record	1
Canadian Forest Service, Atlantic Forestry Centrelocation not on record	1

3 institutions · 11 of 24 vouchered records shown · 13 without an institution code

09Environmental DNA51 detections

Where the DNA of Madremyia saundersii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found51

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 51 detections have coordinates

Open the map2 countries0

5. Wetlands (inland)Forest1. Forest & Woodland|1.4. Temperate Forest1. Forest & Woodland4. Native Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 12.6–20.7

Seasonal swing summer↔winter19.7 °C

Max temp (day)23.4 °C 19.0–28.1

Min temp (night)10.7 °C 7.50–16.2

Precipitation21.3 mm/mo 5.30–81.8

Air humidity46.0 % 40.2–58.7

Moisture balance-122 mm/mo -186–-45.6

Vapour deficit1,007 Pa 678–1,388

Wind speed3.40 m/s 2.10–5.60

Cloud cover33.8 % 13.1–45.8

CHELSA 1981–2010, ~9 km grid, at location & month of 48 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)