Madarellus undulatus

(Say & T., 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Madarellus

At a glance

Occurrence records842

Data sources5

Biological traits0

DNA specimens92

eDNA detections90

Sources5 archives

Databases and archives Madarellus undulatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility842 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI90 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics92 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF842 records

Environmental DNA1 datasets · 2 countries90 detections

DNA & barcodingBOLD92 specimens

01Narrative

Madarellus undulatus is a species of weevils belonging to the Baridinae subfamily. It is 2.8 - long and have brown coloured head and black or sometimes reddish body. The prothorax is glossy and somewhat punctate with striate elytron. M. undulatus can be found in both Canada (Ontario and Quebec) and everywhere in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding92 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Madarellus undulatus has left across the world's sequence archives.

At a glance

DNA specimens92

BINs1

Marker genes1

eDNA detections90

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus78 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

1Amostly conserved

31Amostly conserved

49Tmostly conserved

73Amostly conserved

181Gmostly conserved

262Amostly conserved

331Amostly conserved

625Gmostly conserved

AACCCTATATTTTATTTTTGGAGCATGATCAGGAATAATTGGTACCTCTATAAGAATAATTATCCGCACAGAACTTGGAAATCCTGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.75%

Haplotypes7

BIN1

Most divergent pair1.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ithyporus stolidussame family15.8%Celetes decolorsame family16.4%Magdalis ruficornissame family16.9%Hylesinus crenatussame family17.0%Sachalinobia rugipennissame order17.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type842 records

Wild obs. + sensor591

Museum / vouchered251

Range

Area of Occupancy AOO2 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 284≤1 km 98≤10 km 37>10 km 65

484 georeferenced · 107 without coordinates

Open the mapobservation + sensor591

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 1≤1 km 3≤10 km 11>10 km 6

21 georeferenced · 230 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	56
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	33
Mississippi State, US	25
University of Guelphlocation not on record	15
University of Tennessee at Chattanoogalocation not on record	15
Lexington, US	10
Wuzhou, CN	5
Cambridge, US	5
University Park, US	5
College Station, US	3
CUlocation not on record	2
ASUlocation not on record	2
Toronto, CA	2
Biodiversity Institute of Ontariolocation not on record	1
Philadelphia, US	1
University of Alabamalocation not on record	1
Lake Placid, US	1
Centre for Biodiversity Genomicslocation not on record	1

18 institutions · 183 of 251 vouchered records shown · 68 without an institution code

09Environmental DNA90 detections

Where the DNA of Madarellus undulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found90

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 90 detections have coordinates

Open the map2 countries0

farmForest14. Artificial - Terrestrial|14.5 Urban Areas5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Temperate mixed forestMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.90 °C 6.20–15.0

Seasonal swing summer↔winter26.4 °C

Max temp (day)12.4 °C 10.1–18.9

Min temp (night)1.90 °C 1.70–12.6

Precipitation75.0 mm/mo 66.1–86.9

Air humidity55.2 % 54.8–57.7

Moisture balance-18.3 mm/mo -28.6–0.9

Vapour deficit450 Pa 420–699

Wind speed4.00 m/s 2.80–4.70

Cloud cover48.0 % 43.3–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)