Macugonalia moesta

(Fabricius, 1803) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Macugonalia

At a glance

Occurrence records559

Data sources5

Biological traits0

DNA specimens7

eDNA detections7

Sources5 archives

Databases and archives Macugonalia moesta's data was compiled from.

GBIFGlobal Biodiversity Information Facility559 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF559 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Macugonalia moesta has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 28 variable positions, in barcode order

79Tmostly conserved

82Amostly conserved

88Gmostly conserved

103Tmostly conserved

115Cmostly conserved

169Tmostly conserved

187Cmostly conserved

190Amostly conserved

226Cmostly conserved

247Cmostly conserved

271Avariable

295Gvariable

304Gmostly conserved

313Avariable

316Gvariable

337Avariable

409Gvariable

428Tvariable

466Avariable

478Gmostly conserved

493Avariable

496Gvariable

499Cvariable

518Tmostly conserved

553Tvariable

583Avariable

622Gvariable

625Tmostly conserved

TACATTATATTTCATTTTTGGGATTTGATCTGGTATAGTTGGAATAATACTTAGTATAATTATCCGAATTGAATTAGCTCAACCCGGGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes4

BINs2

Most divergent pair0.46%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neokolla hieroglyphicasame family16.2%Homalodisca ichthyocephalasame family16.3%Homalodisca vitripennissame family16.4%Helochara communissame family16.6%Helochara deltasame family16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type559 records

Wild obs. + sensor517

Museum / vouchered42

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 226≤1 km 108≤10 km 42>10 km 23

399 georeferenced · 118 without coordinates

Open the mapobservation + sensor517

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	34
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	8

2 institutions · 42 of 42 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Macugonalia moesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

1. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 20.5–23.8

Seasonal swing summer↔winter2.90 °C

Max temp (day)25.4 °C 23.6–26.8

Min temp (night)19.0 °C 17.4–20.6

Precipitation186 mm/mo 87.3–368

Air humidity68.7 % 67.8–69.3

Moisture balance103 mm/mo 3.80–252

Vapour deficit860 Pa 735–921

Wind speed0.5 m/s 0.5–0.6

Cloud cover53.4 % 41.0–64.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)