Macrodiplodiopsis desmazieri

(Mont.) Petr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Macrodiplodiopsidaceae/Macrodiplodiopsis

At a glance

Occurrence records60

Data sources5

Biological traits0

DNA specimens0

eDNA detections2

Sources5 archives

Databases and archives Macrodiplodiopsis desmazieri's data was compiled from.

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF60 records

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Macrodiplodiopsis desmazieri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections2

Countries6

The DNA barcodea real sequence read deposited for this species

ITSKR873237.1 ↗582 bpGermany

ACGT

GTCGCCTCCGGGCGGTCCGTTGCTGAGTGCTGGTCTGCACATGCCCTGTGTCAGTACGCACGCGATCGTGCCGAACCTCAGCCCGTCACC …

Macrodiplodiopsis desmazieri strain CPC 22645 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor44

Museum / vouchered16

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 29≤1 km 3≤10 km 11

43 georeferenced · 1 without coordinates

Open the mapobservation + sensor44

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 1>10 km 1

4 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WU-MYClocation not on record	8
San Sebastián, ES	1
Gijón, ES	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Copenhagen, DK	1
SLU Artdatabankenlocation not on record	1

6 institutions · 13 of 16 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Macrodiplodiopsis desmazieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)