Macaria carbonaria

(Clerck, 1759) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Macaria

At a glance

Occurrence records2 354

Data sources10

Biological traits2

DNA specimens15

eDNA detections14

Sources10 archives

Databases and archives Macaria carbonaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 354 records

Environmental DNA2 datasets · 5 countries14 detections

DNA & barcodingBOLD15 specimens

Genome at a glanceGoaT · NCBI≈344 Mbp

01Narrative

Macaria carbonaria, the netted mountain moth, is a moth of the family Geometridae. The species was first described by Carl Alexander Clerck in 1759. It is found in the northern part of the Palearctic realm. The wingspan is 23 -. Adults are on wing from April to June. It is a day-flying species and can be found visiting the flowers of various plants. The larvae feed on Arctostaphylos uva-ursi.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Macaria carbonaria has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections14

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

88Amostly conserved

235Tmostly conserved

532Cmostly conserved

541Gmostly conserved

565Gvariable

580Amostly conserved

624Gmostly conserved

625Amostly conserved

627Gmostly conserved

628Amostly conserved

AACTTTATACTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.40%

Haplotypes7

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Semiothisa salsasame family6.5%Macaria bitactatasame genus6.5%Macaria austrinatasame genus6.7%Macaria fuscasame genus6.7%Macaria quadrilineariasame genus6.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Macaria carbonaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈343 707 682 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Macaria carbonaria0.34 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.7% BUSCO

08Occurrence & distribution

Record type2 354 records

Wild obs. + sensor1 352

Museum / vouchered999

Other3

Origin

Native115

Range

Area of Occupancy AOO2 328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 212≤1 km 509≤10 km 601>10 km 3

1 325 georeferenced · 27 without coordinates

Open the mapobservation + sensor1 352

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 25≤1 km 106≤10 km 288>10 km 15

434 georeferenced · 565 without coordinates

Open the institutions mapphysical evidence999

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	509
Zürich, CH	112
Tartu, EE	88
DanishLepidopterologicalSocietylocation not on record	48
Glarus, CH	37
Tromsø, NO	35
Dhaka, BD	24
Bern, CH	23
Philadelphia, US	17
SLU Artdatabankenlocation not on record	17
Salzburg, AT	13
Naturmuseum Solothurnlocation not on record	11
Adam Mickiewicz University in Poznańlocation not on record	5
Universität Zürich, Naturhistorisches Museumlocation not on record	4
Fribourg, CH	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
CBDClocation not on record	2
NHMOlocation not on record	2
Stockholm, SE	1
Muzeum Górnośląskie w Bytomiulocation not on record	1
Geneva, CH	1
BioFokuslocation not on record	1
Provincia di Livornolocation not on record	1
Uniwersytet Łódzkilocation not on record	1
ZSMlocation not on record	1
Research Collection of Aurelien GAUNETlocation not on record	1

26 institutions · 959 of 999 vouchered records shown · 40 without an institution code

09Environmental DNA14 detections

Where the DNA of Macaria carbonaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys2

Countries5

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.40 °C 3.60–10.7

Seasonal swing summer↔winter20.7 °C

Max temp (day)11.4 °C 7.10–13.0

Min temp (night)1.90 °C -2.00–6.70

Precipitation134 mm/mo 58.0–157

Air humidity63.3 % 56.9–64.3

Moisture balance33.9 mm/mo -24.3–60.0

Vapour deficit400 Pa 288–500

Wind speed2.50 m/s 2.30–4.10

Cloud cover41.2 % 37.6–62.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Macaria carbonaria

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 354 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 354 records