Lysurus cruciatus

(Lepr. & Mont.) Henn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Phallales/Phallaceae/Lysurus

At a glance

Occurrence records289

Data sources8

Biological traits0

DNA specimens10

eDNA detections77

Sources8 archives

Databases and archives Lysurus cruciatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility289 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF289 records

Environmental DNA5 datasets · 3 countries77 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Lysurus cruciatus or the lizard's-claw stinkhorn is a species of fungus in the stinkhorn family. It was first described scientifically in 1845 by French botanists François Mathias René Leprieur and Camille Montagne as Aserophallus cruciatus. German mycologist Paul Christoph Hennings transferred it to the genus Lysurus in 1902. Its fruit bodies feature a white, cylindrical tube supporting a cluster of hollow, reddish pointed arms whose surface is covered with foul-smelling spore mass, or gleba. The gleba is brownish to greenish in color, and contains spores with dimensions of 3–4 by 1.5–2 µm. In 1901, this mushroom was rediscovered in Inanda, Natal. This "new" find was named L. Woodii, which was later corrected to be the previously discovered L. Cruciatus.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lysurus cruciatus has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences8

eDNA detections77

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPV702227.1 ↗525 bpIndia · 2024

ACGT

TATTCGAGGGAAACCTCGTTCAATATATTACAAACACCTCGTGCACCTCTACGTGAAAGGAAGTGAAAGGGTTCGTCCCCCTCTTCCGTT …

Lysurus cruciatus voucher SR_2411 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type289 records

Wild obs. + sensor235

Museum / vouchered54

Range

Area of Occupancy AOO936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 109≤1 km 32≤10 km 27>10 km 24

192 georeferenced · 43 without coordinates

Open the mapobservation + sensor235

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 2≤10 km 2

4 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	16
Ensenada, MX	5
Universidade Federale do Rio Grande do Sullocation not on record	2
Denver, US	1
Chicago, US	1
BDBClocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Champaign, US	1
ILLSlocation not on record	1

9 institutions · 29 of 54 vouchered records shown · 19 without an institution code

09Environmental DNA77 detections

Where the DNA of Lysurus cruciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys5

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature18.0 °C

pH6.70 4.70–7.90

Conductivity77.0 µS/cm 13.0–673

Organic carbon2.37 % 0.25–5.51

Water content10.5 % 4.02–17.0

Nitrate-N13.0 mg/kg 1.00–284

Phosphorus24.0 mg/kg 4.00–63.0

Clay12.2 % 3.85–54.0

Sand77.7 % 17.9–92.2

Depth0 m 0–0.2

SoilTenosolVertosolDermosolFerrosolSodosol

31 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.8–16.3

Seasonal swing summer↔winter14.0 °C

Max temp (day)20.1 °C 19.4–22.4

Min temp (night)9.00 °C 8.20–10.9

Precipitation57.0 mm/mo 37.1–92.1

Air humidity55.8 % 52.9–58.9

Moisture balance-77.8 mm/mo -105–-28.5

Vapour deficit823 Pa 695–953

Wind speed3.20 m/s 2.00–3.60

Cloud cover25.8 % 23.4–26.3

CHELSA 1981–2010, ~9 km grid, at location & month of 72 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)