Lysimachia vulgaris
speciesAt a glance
Occurrence records610 142
Data sources14
Biological traits68
DNA specimens48
eDNA detections22
Sources14 archives
Databases and archives Lysimachia vulgaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility610 142 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources68 traits
Chemical compositionLOTUS · NPASS39 compounds
Occurrence & distributionGBIF610 142 records
Environmental DNA1 datasets · 6 countries22 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GoaT2.3 Gbp
01Narrative
La Lysimaque commune encore appelée Grande lysimaque est une espèce de plantes à fleurs de la famille des Primulacées selon la classification classique et la classification phylogénétique APG III (2009).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology26
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Fruit width3 mm
Fruit width max3 mm
Fruit width min3 mm
Leaf length65 mm
⚠ sources differ — AusTraits: 65 mm · GIFT: 115 mm
Leaf length max170 mm
Leaf length min60 mm
Leaf mass94.77 mg
Leaf size2 784 mm²
⚠ sources differ — TRY: 2 784 mm² · LEDA: 2 310 mm² · GIFT: 2 539 mm²
Leaf width31 mm
Leaf width max50 mm
Leaf width min12 mm
Petiole length0.3 cm
Plant height0.898 m
⚠ sources differ — GIFT: 0.898 m · AusTraits: 1.25 m · LEDA: 0.967 m · TRY: 0.948 m
Plant height generative0.619 m
Plant height max1.5 m
Plant height min0.5 m
Seed length1.47 mm
⚠ sources differ — TRY: 1.47 mm · AusTraits: 1 mm
Seed mass0.322 mg
⚠ sources differ — TRY: 0.322 mg · AusTraits: 0.334 mg · LEDA: 0.352 mg · GIFT: 0.236 mg
Seed mass max0.14 mg
Seed mass min0.14 mg
Seed volume0.35 mm³
Seed volume max0.35 mm³
Seed volume min0.35 mm³
Life cycle & reproduction16
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: autochorous
Flowering endAug
Flowering startJun
Flowering timenynnnnnnnnnn
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 134
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max700 m
Elevation mean600 m
Elevation min500 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTforest, meadows: wet, rivers, shrubberies
Leaf compoundnesssimple
Leaf shapeelliptical narrowly_elliptical oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf c449 mg/g
Leaf dry-matter content (LDMC)204 mg/g
Leaf n25.68 mg/g
Leaf p2.1 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)24.04 mm²/mg
⚠ sources differ — TRY: 24.04 mm²/mg · LEDA: 24.4 mm²/mg · GIFT: 26.32 mm²/mg
Wood density224 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition39 compounds
Compounds documented for Lysimachia vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Flavonols6
Oleanane triterpenoids1
Avermectins1
Documented compounds39 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Abamectin Component B1A | present | NPASS | |
| AFSHKCWTGFDXJR-FSGZSHNRSA-N | present | NPASS | |
| AFSHKCWTGFDXJR-NBHOAJIMSA-N | present | NPASS | |
| AFSHKCWTGFDXJR-SQOHEDJBSA-N | present | NPASS | |
| Astragalin | present | LOTUS | |
| AZSNMRSAGSSBNP-LFOOHIAMSA-N | present | NPASS | |
| CAJDUHQNQRQATN-MAMUBCSZSA-N | present | NPASS | |
| CUJFGSBWDMADEI-SNCDAFNHSA-N | present | NPASS | |
| CWGATOJEFAKFBK-PDVFGPFMSA-N | present | NPASS | |
| FESJRKLWENAEBD-IYUMCDNJSA-N | present | NPASS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lysimachia vulgaris has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes7
GenBank sequences10
eDNA detections22
Countries10
The DNA barcodea real sequence read deposited for this species
AGGAAATTAAACAAAGAGATTGCGCCCCCCCACTCCCGTCCGCGGGTTGTGACCGGGGATAGCATCTTGCATATAATAAAACGACTCTCG …
Lysimachia vulgaris voucher KS23 HER0512 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Lysimachia vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 259 180 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lysimachia vulgaris2.26 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 84 n = 42
Ploidypolyploid inferred
Chromosome records28–842n range42median84mode43records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 8415×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · poland +4
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Al-Bermani, A.-K.K.A., Al-Shammary, K.I.A., Bailey, J.P., Gornall, R.J. Watsonia 19: 269-271 (1993)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Pervichnyj citogeneticheskij monitoring flory Belorussii. Izv. Akad. Nauk Azerbajdzansk. SSR, Ser. Biol. Nauk 6: 8–11.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Al-Bermani, A. K. K. A., K. I. A. Al-Shammary, R. J. Gornall & J. P. Bailey. 1993. Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169–171.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Chromosome numbers of flowering plants in the Netherlands IV. Proc. Roy. Netherlands Acad. Sci. ser. C. 71: 168-183.
CCDB · book-ipcn75-78 — Skalinska et al. 1976
CCDB · CromoCat 2015 — Al-Bermani, A.-K. K. A., Al-Shammary, K. I. A., Gornall, R. J. & Bailey, J. P. (1993). Contribution to a cytological catalogue of the British and Irish flora, 3. Watsonia 19: 169-171.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988b). Pervichnyj citogeneticheskij monitoring flory Belorussii. Izvestiia Akademii Nauk Azerbaidzhanskoi SSR, Seriia Biologicheskikh Nauk 6: 8-11.
CCDB · CromoCat 2015 — Skalinska, M. (1976). Further studies in chromosome numbers of Polish Angiosperms. Part XI. Acta Biol. Cracov., Ser. Bot. 19: 107-148.
2n 4214×CCDB · slov-fl · CCDB · iapt · CCDB · ipcn-api-dl +2
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · book-ipcn67-71 — GADELLA, T.W.J., & E. KLIPHUIS. 1971. Chromosome numbers of flowering plants in the Netherlands v. Proc. Kon. Ned. Acad. Wetensch. ser C 74:
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A. & Rosbakh, S. A. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1298-1299
CCDB · CromoCat 2015 — Dmitrieva, S. A. (2000). Karyology of the flora of Byelarus Page 42 Thesis of the Diss. Doc. Biol. Sci. Minsk. Minsk
CCDB · CromoCat 2015 — Krasnikov, A. A. (1991). Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žurn. 76: 476-479.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1991). Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR) Bot. Žurn. 76: 473-476.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1985). Kariologicheskaja differenciacija u vidov flory Belorussii i ee rol, v formoobrazovanii. Dokl. Akad. Nauk Byelorussk. SSR. (Minsk) 29(6): 544-557.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
2n 2811×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-fedorov +2
CCDB · slov-fl — Uhríková A., Májovský J. & Schwarzová T., 1986: Karyological study of the Slovakian flora XV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 73-76.
CCDB · slov-fl — Váchová M. & Feráková V., 1986: Karyological study of the Slovak flora XII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 57-62.
CCDB · ipcn-api-dl — Uhríková, A., J. Májovský & T. Schwarzová. 1986. Karyological study of the Slovak flora XV. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 73–76.
CCDB · ipcn-api-dl — Váchová, M. & V. Feráková. 1986. Karyological study of the Slovak flora XII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 57–62.
CCDB · book-fedorov — JleBHTCKJiii (T. 1937)
CCDB · book-fedorov — Rohweder 1937 '
CCDB · book-fedorov — JiesurcKRii: H AP
CCDB · book-atlas-flowering-plants — Lewitzky 1934
CCDB · CromoCat 2015 — Peev, D. (1976a). Chromosome numbers and critical notes on the taxonomy of some Bulgarian Primulaceae species. Fitologija 4: 16-24.
CCDB · CromoCat 2015 — Uhríková, A. & T. Schwarzová. (1986). Karyological study of the Slovak flora XV Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica 33: 73-76
CCDB · CromoCat 2015 — Váchová, M. & V. Feráková. (1986). Karyological study of the Slovak flora XII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 57-62
2n 563×CCDB · book-fedorov · CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · book-fedorov — Gadella, Kliphuis 1963, 1966
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1963). Chromosome numbers of flowering plants in the Netherlands. Acta Bot. Neerl. 12(2): 195-230.
n 212×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Rostovtseva, T. S., I. M. Krasnoborov & S. A. Krasnikova. 1981. Chisla khromosom nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 215–220.
CCDB · CromoCat 2015 — Rostovtseva, T. S., Krasnoborov, I. M. & Krasnikova, S. A. (1981). Chisla kromosom nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri 215-220.
n 282×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
CCDB · CromoCat 2015 — Laane, M. M. (1969a). Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type610 142 records
Wild obs. + sensor584 501
Museum / vouchered22 012
Cultivated / captive47
Other3 582
Origin
Native8 168
Introduced114
Range
Area of Occupancy AOO540 696 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy51% within 1 km
≤100 m 128 706≤1 km 95 384≤10 km 211 962>10 km 2 508
438 560 georeferenced · 145 941 without coordinates
Open the mapobservation + sensor584 501
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 890≤1 km 6 060≤10 km 11 482>10 km 381
18 813 georeferenced · 3 199 without coordinates
Open the institutions mapphysical evidence22 012
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 16
19 georeferenced · 28 without coordinates
Open the mapnot free-living47
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions108 of 211 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 15 391 |
| Moscow State Universitylocation not on record | 415 |
| LDlocation not on record | 362 |
| BFLlocation not on record | 318 |
| Olocation not on record | 264 |
| BIO-UNIPIlocation not on record | 223 |
| MeiseBGlocation not on record | 215 |
| Salzburg, AT | 206 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 191 |
| Oulu, FI | 170 |
| Oskarshamn, SE | 147 |
| Adam Mickiewicz University in Poznańlocation not on record | 133 |
| Jyväskylä, FI | 125 |
| Uniwersytet Warszawskilocation not on record | 112 |
| Turku, FI | 112 |
| Kuopio, FI | 97 |
| Bergen, NO | 96 |
| SLU Artdatabankenlocation not on record | 90 |
| Trondheim, NO | 86 |
| MAlocation not on record | 82 |
| TUR-Alocation not on record | 59 |
| KMNlocation not on record | 57 |
| Entomological Society of Latvialocation not on record | 51 |
| Tallinn, EE | 47 |
| South Kensington, GB | 46 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 45 |
| Görlitz, DE | 42 |
| Philadelphia, US | 41 |
| Philadelphia, US | 39 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 38 |
| BRNUlocation not on record | 37 |
| Zürich, CH | 37 |
| Provincia di Livornolocation not on record | 36 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 35 |
| BDBClocation not on record | 34 |
| València, ES | 33 |
| Chongqing Museumlocation not on record | 29 |
| Vitoria, ES | 28 |
| Porvoo, FI | 28 |
| Museo Entomologico de Leonlocation not on record | 25 |
| Barcelona, ES | 23 |
| Bern, CH | 22 |
| Uppsala, SE | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 21 |
| Wlocation not on record | 21 |
| Berlin, DE | 21 |
| Frankfurt am Main | 20 |
| DBF-NHMDlocation not on record | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 20 |
| CICYTEXlocation not on record | 20 |
| Salamanca, ES | 19 |
| Natural History Museum Rotterdamlocation not on record | 19 |
| CJBGlocation not on record | 18 |
| ISAlocation not on record | 18 |
| GJOlocation not on record | 18 |
| Mlocation not on record | 16 |
| Helsinki, FI | 16 |
| Urumqi, CN | 16 |
| WTUlocation not on record | 15 |
| Tula State Universitylocation not on record | 14 |
| Winterthur, CH | 13 |
| Burlington, US | 13 |
| TROMlocation not on record | 12 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 12 |
| Madrid, ES | 12 |
| Badajoz, ES | 11 |
| Université Lavallocation not on record | 11 |
| Porrentruy, CH | 11 |
| Tilburg, NL | 11 |
| University of New Hampshirelocation not on record | 11 |
| Tartu, EE | 11 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 11 |
| Madison, US | 10 |
| Québec, CA | 10 |
| Zürich, CH | 10 |
| Museo Achille Folettolocation not on record | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Pamplona, ES | 8 |
| Dresden, DE | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Rovaniemi, FI | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| BClocation not on record | 8 |
| Saint Louis, US | 7 |
| Dekalb, US | 7 |
| UGentlocation not on record | 7 |
| Metsähallituslocation not on record | 7 |
| Karlsruhe, DE | 7 |
| NMBU:MINAlocation not on record | 7 |
| LfUlocation not on record | 7 |
| Bronx, US | 7 |
| Podgorica, ME | 7 |
| Montréal, CA | 6 |
| Vancouver, CA | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Glarus, CH | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Christchurch, NZ | 6 |
| Fulda, DE | 5 |
| Beijing, CN | 5 |
| St. Paul, US | 5 |
| GZUlocation not on record | 5 |
| Millersville, US | 5 |
| Pamplona, ES | 5 |
| Uniwersytet Opolskilocation not on record | 5 |
| Stockholm, SE | 5 |
| Frauenfeld, CH | 4 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 4 |
| nbflocation not on record | 4 |
| Toronto, CA | 4 |
| Tampere, FI | 4 |
| Allentown, US | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| Alicante, ES | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Kew, GB | 4 |
| Bourges, FR | 3 |
| Austin, US | 3 |
| Hobart, AU | 3 |
| Philadelphia, US | 3 |
| PRClocation not on record | 3 |
| College Park, US | 3 |
| Chicago, US | 3 |
| Wellington, NZ | 3 |
| Whitehorse, CA | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Durham, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Acadia Universitylocation not on record | 3 |
| BSBIlocation not on record | 3 |
| Forssa, FI | 3 |
| Saint John, CA | 2 |
| Xiamen, CN | 2 |
| Monastir, TN | 2 |
| New Haven, US | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Granada, ES | 2 |
| Missoula, US | 2 |
| Corvallis, US | 2 |
| RJBJCIlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Sion, CH | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| Keene State Universitylocation not on record | 2 |
| München, DE | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Banyoles, ES | 2 |
| SNSNMClocation not on record | 2 |
| University of Hulllocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| SZUlocation not on record | 2 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Hudson, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| Victoria, CA | 1 |
| Bothell, US | 1 |
| UoB-IBlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Gijón, ES | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Boise, US | 1 |
| Cheney, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Taipei, TW | 1 |
| FLADlocation not on record | 1 |
| Xining, CN | 1 |
| Morgantown, US | 1 |
| Beijing, CN | 1 |
| Staten Island, US | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| WNNUlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Riverside, US | 1 |
| BGBMlocation not on record | 1 |
| Dhaka, BD | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| New Brunswick, US | 1 |
| Universität Göttingenlocation not on record | 1 |
| Namur, BE | 1 |
| Elikins, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Ann Arbor, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Nijmegen, NL | 1 |
| McWane Science Centerlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Göteborg, SE | 1 |
| Bloomington, US | 1 |
| Paris, FR | 1 |
| Canberra, AU | 1 |
| Whitewater, US | 1 |
| Pullman, US | 1 |
| Armidale, AU | 1 |
| Wuzhou, CN | 1 |
| Oswego, US | 1 |
| Auckland, NZ | 1 |
| ZRC-SAZUlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Denver, US | 1 |
211 institutions · 20 568 of 22 012 vouchered records shown · 1 153 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Lysimachia vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map6 countries0
Marshy margin of river, scattered clumpswetland edgeClay riverbed and shoreline; gravel shore ju…moist edge of flooded inletWet meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 10.3–21.2
Seasonal swing summer↔winter19.2 °C
Max temp (day)19.7 °C 13.8–24.3
Min temp (night)13.6 °C 6.60–18.2
Precipitation81.5 mm/mo 62.0–109
Air humidity62.0 % 59.0–64.7
Moisture balance-23.0 mm/mo -53.9–1.50
Vapour deficit733 Pa 491–1,024
Wind speed3.20 m/s 2.20–4.70
Cloud cover46.5 % 39.8–52.9
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.