Lygocoris rugicollis

(Fallen, 1807) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Lygocoris

At a glance

Occurrence records1 421

Data sources7

Biological traits0

DNA specimens36

eDNA detections172

Sources7 archives

Databases and archives Lygocoris rugicollis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 421 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI172 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 421 records

Environmental DNA4 datasets · 8 countries172 detections

DNA & barcodingBOLD36 specimens

01Narrative

Lygocoris rugicollis is a widespread, common species of bug in the Miridae family. It feeds on a large variety of bushes and small trees, but especially willows (members of the Salicaceae) and slightly less often alders (members of the Betulaceae). It can be found throughout Europe, including the UK, and Spain, in North Africa, as far east as Central Asia,Vinokurov has reported it from the Tian Shan. in Alaska and Canada, including the Maritimes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lygocoris rugicollis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes1

eDNA detections172

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

65Amostly conserved

260Gmostly conserved

635Amostly conserved

638Tmostly conserved

CTTTATATTTTATCTTTGGAATATGAGCAGGAATATTAGGGACATCACTAAGATGAATTATTCGAATTGAATTAGGAATACCAGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes6

BIN1

Most divergent pair0.30%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lygus vanduzeeisame family11.4%Lygus elisussame family12.0%Lygus borealissame family12.0%Lygus striatussame family12.3%Lygus shullisame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 421 records

Wild obs. + sensor921

Museum / vouchered483

Other17

Range

Area of Occupancy AOO3 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 408≤1 km 308≤10 km 189>10 km 2

907 georeferenced · 14 without coordinates

Open the mapobservation + sensor921

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 273≤1 km 94≤10 km 75>10 km 3

445 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence483

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	71
Edmonton, CA	39
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	33
Rovaniemi, FI	20
Natural History Museum, Aarhus Denmarklocation not on record	20
Tromsø, NO	19
CBDClocation not on record	17
Philadelphia, US	10
SLU Artdatabankenlocation not on record	9
DFlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
Jyväskylä, FI	3
ZMAAlocation not on record	3
Winterthur, CH	3
San Francisco, US	2
WGSlocation not on record	1
NTNU-VMlocation not on record	1
Metsähallituslocation not on record	1
Helsinki, FI	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
neflocation not on record	1
Forssa, FI	1

23 institutions · 266 of 483 vouchered records shown · 217 without an institution code

09Environmental DNA172 detections

Where the DNA of Lygocoris rugicollis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found172

Studies independent surveys4

Countries8

Verifiable raw sequence linked136

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 172 detections have coordinates

Open the map8 countries0

17. Other1. Forest|1.2 Subarctic ForestAlpine willow zoneMixed habitat1. Forest & Woodland | 1.1. Boreal Forest4. Native Grassland | 4.1. Tundra

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 9.50–15.8

Seasonal swing summer↔winter21.8 °C

Max temp (day)16.1 °C 11.6–19.2

Min temp (night)8.90 °C 5.20–11.4

Precipitation88.8 mm/mo 57.7–143

Air humidity59.6 % 56.0–64.4

Moisture balance-13.9 mm/mo -42.7–51.9

Vapour deficit610 Pa 419–734

Wind speed2.70 m/s 1.90–4.50

Cloud cover52.5 % 45.8–62.2

CHELSA 1981–2010, ~9 km grid, at location & month of 171 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lygocoris rugicollis

At a glance

Sources7 archives

At a glance

Record type1 421 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 421 records