Lycoperdon subincarnatum

Peck · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Lycoperdaceae/Lycoperdon

At a glance

Occurrence records390

Data sources7

Biological traits0

DNA specimens0

eDNA detections7

Sources7 archives

Databases and archives Lycoperdon subincarnatum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility390 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF390 records

Environmental DNA4 datasets · 3 countries7 detections

DNA & barcodingNCBIsequences

01Narrative

Lycoperdon subincarnatum is a type of puffball mushroom in the genus Lycoperdon (family Agaricaceae). It was first officially described in 1872 by American mycologist Charles Horton Peck. The puffball is found in North America and China.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lycoperdon subincarnatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections7

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPX927884.1 ↗413 bpSouth Korea · 2025

ACGT

TAACAAGGTTTCGTAGGTGAACCTGCGGAAGGATCATTATTGAATATACTTGATGGGTTGTAGCTGGCTCTATGGGGCATGTGCACGCTT …

Morganella subincarnata voucher KA25-1043 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type390 records

Wild obs. + sensor218

Museum / vouchered171

Other1

Range

Area of Occupancy AOO1 080 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 65≤1 km 51≤10 km 17>10 km 6

139 georeferenced · 79 without coordinates

Open the mapobservation + sensor218

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 7≤1 km 19≤10 km 91>10 km 16

133 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence171

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	46
Chapel Hill, US	23
Brisbane, AU	17
Toronto, CA	12
Catholic University of Pekinglocation not on record	11
DPIlocation not on record	11
Museo Entomologico de Leonlocation not on record	9
Bronx, US	7
FLASlocation not on record	7
Chicago, US	6
TENN-Flocation not on record	6
Ann Arbor, US	2
Logan, US	1
Pullman, US	1
Tartu, EE	1
Centro de Estudios Superiores del Estado de Sonoralocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Canberra, AU	1
Madison, US	1

19 institutions · 164 of 171 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Lycoperdon subincarnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys4

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.80 4.60–6.00

Conductivity44.5 µS/cm 11.0–78.0

Organic carbon0.77 % 0.37–3.13

Water content8.12 % 7.92–8.31

Nitrate-N18.0 mg/kg

Phosphorus8.00 mg/kg 5.00–9.00

Clay7.59 % 5.97–17.5

Sand85.9 % 73.8–86.6

Depth0 m 0–0.2

SoilSodosolDermosols

3 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 13.9–24.1

Seasonal swing summer↔winter12.2 °C

Max temp (day)27.2 °C 17.9–28.0

Min temp (night)17.8 °C 10.2–20.6

Precipitation135 mm/mo 99.6–215

Air humidity58.9 % 58.9–65.2

Moisture balance7.90 mm/mo 3.10–79.1

Vapour deficit1,103 Pa 627–1,124

Wind speed1.70 m/s 1.60–3.10

Cloud cover26.0 % 26.0–57.2

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)