Lycoperdon curtisii

Berk. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Lycoperdaceae/Lycoperdon

At a glance

Occurrence records523

Data sources9

Biological traits0

DNA specimens0

eDNA detections2

Sources9 archives

Databases and archives Lycoperdon curtisii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility522 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS523 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Lycoperdon curtisii is a type of puffball mushroom in the genus Lycoperdon. It was first described scientifically in 1859 by Miles Joseph Berkeley. Vascellum curtisii, published by Hanns Kreisel in 1963, is a synonym. Its fruit bodies (puffballs) have been recorded growing in fairy rings. It is nonpoisonous.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lycoperdon curtisii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR792666.1 ↗642 bpChina

ACGT

GATGAGTTGTAGCTGGCTCTCCGGGGCATGTGCACGCTTGTCTTGATTTTATTCATCCACCTGTGCACCTTTTGTAGTCTTGGGGGTTGA …

Lycoperdon curtisii isolate GX20170590 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type523 records

Wild obs. + sensor378

Museum / vouchered140

Other5

Range

Area of Occupancy AOO1 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 162≤1 km 39≤10 km 32>10 km 38

271 georeferenced · 107 without coordinates

Open the mapobservation + sensor378

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 24≤10 km 58>10 km 25

109 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	51
TENN-Flocation not on record	9
Davis and Elkins Collegelocation not on record	8
ILLSlocation not on record	7
Lincoln, US	6
St. Paul, US	6
Toronto, CA	5
FLASlocation not on record	5
Chapel Hill, US	5
Champaign, US	4
CA	3
Bronx, US	3
Chicago, US	3
McWane Science Centerlocation not on record	3
Catholic University of Pekinglocation not on record	3
Pullman, US	2
Colorado State Universitylocation not on record	2
Madison, US	2
Blacksburg, US	2
Tartu, EE	1
WTUlocation not on record	1
Denver, US	1
Clemson, US	1
Brown Universitylocation not on record	1

24 institutions · 134 of 140 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Lycoperdon curtisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.7–24.7

Seasonal swing summer↔winter4.50 °C

Max temp (day)25.2 °C

Min temp (night)24.1 °C

Precipitation84.9 mm/mo

Air humidity62.3 %

Vapour deficit1,169 Pa

Cloud cover28.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)