Lycoperdon americanum — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Lycoperdaceae/Lycoperdon

At a glance

Occurrence records44

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Lycoperdon americanum's data was compiled from.

GBIFGlobal Biodiversity Information Facility44 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF44 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lycoperdon americanum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON176068.1 ↗529 bpUSA

ACGT

CCCCCCAAAAAAAAGGGCCAGCACAGCAGCATCCAGCCAGGTGGTTTCGTTCGATAATGATCCTTCCGTAGGTGAACCTGCGGAAGGATC …

Lycoperdon americanum voucher iNAT:55222250 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor26

Museum / vouchered18

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 6≤1 km 1≤10 km 8>10 km 3

18 georeferenced · 8 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 3≤10 km 1>10 km 3

7 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4
WTUlocation not on record	4
Davis and Elkins Collegelocation not on record	2
Chapel Hill, US	2
Université de Montréal Biodiversity Centrelocation not on record	2
University of Tennessee at Chattanoogalocation not on record	1
Ann Arbor, US	1
St. Paul, US	1
ILLSlocation not on record	1

9 institutions · 18 of 18 vouchered records shown