Lycium barbarum
speciesAt a glance
Occurrence records34 960
Data sources14
Biological traits55
DNA specimens41
eDNA detections30
Sources14 archives
Databases and archives Lycium barbarum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility34 960 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics41 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionLOTUS · NPASS243 compounds
Occurrence & distributionGBIF34 960 records
Environmental DNA1 datasets · 4 countries30 detections
DNA & barcodingBOLD · NCBI41 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2.1 Gbp
01Narrative
Le lyciet commun ou lyciet de Barbarie est un arbuste de la famille des Solanaceae, largement répandu de l'Europe à l'Asie. En France, on peut observer dans la nature trois espèces de Lycium : le Lycium europaeum, le Lycium barbarum et le Lycium chinense. Les deux premiers sont indigènes d'Europe et le troisième L. chinense a été introduit d'Asie orientale et s'est naturalisé en de nombreux endroits. Les lyciets qui étaient connus dans la pharmacopée antique du monde gréco-latin furent oubliés et ce n'est qu'à la suite du développement de la Chine depuis la fin des années 1990 qu'ils nous sont revenus sous le nom commercial de « baies de goji ». Le lyciet commun est une des deux espèces de Lycium donnant des fruits rouges en vente dans les magasins de diététique sous le nom de baies de goji. C'est la plus riche des deux en vitamines, minéraux et antioxydants. Les fruits très réputés en Asie pour leurs propriétés antioxydantes sont inscrits à la pharmacopée chinoise. Deux variétés sont connues : - Lycium barbarum var. auranticarpum K. F. Ching - Lycium barbarum var. barbarum
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 25 mm
Fruit width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 2 mm
Leaf length22.5 mm
Leaf length max30 mm
Leaf mass46.08 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 311 mm² · GIFT: 1 311 mm²
Leaf width5 mm
⚠ sources differ — AusTraits: 5 mm · GIFT: 10 mm
Leaf width max20 mm
Leaf width min8 mm
Plant height1.73 m
⚠ sources differ — GIFT: 1.73 m · AusTraits: 2.5 m · LEDA: 2 m · TRY: 2.15 m
Plant height generative2 m
Plant height max3 m
Plant height min1 m
Seed length2 mm
Seed mass1.73 mg
Seed mass max2.63 mg
Seed mass min1 mg
Seed width1 mm
Life cycle & reproduction16
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endSep
Flowering startMay
Flowering timeyyyyynnnnnny
Life formshrub
Life spanperennial
Lifespan years5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Seed number29
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub · TRY: Vine, Shrub
Habitat GIFTCoastal
Leaf compoundnesssimple
Leaf shapeelliptical ovate
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry4
Leaf dry-matter content (LDMC)165 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)17.1 mm²/mg
⚠ sources differ — TRY: 17.1 mm²/mg · LEDA: 14.09 mm²/mg · GIFT: 14.09 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition243 compounds
Compounds documented for Lycium barbarum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Other polyketide meroterpenoids26
Glycosyldiacylglycerols15
Fatty alcohols14
Flavonols13
Hydrocarbons11
Documented compounds243 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((1S,5R)-8-Methyl-8-Azabicyclo(3.2.1)Octan-3-Yl) (2R)-3-Hydroxy-2-Phenylpropanoate | present | NPASS | |
| (+)-2,3-Butanediol | present | NPASS | |
| (+)-3-Octanol | present | NPASS | |
| (-)-Acetoin | present | NPASS | |
| (10R)-1,2,8-trihydroxy-6-methyl-10-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-10H-anthracen-9-one | present | NPASS | |
| (1R)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(4R)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2R)-4-[(2R,4S)-2,4-dihydroxy-2,6,6-trimethylcyclohexylidene]but-3-en-2-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S)-1,2-Di-O-Linolenoyl-3-O-Alpha-Galactopyranosyl-(1->6)-O-Beta-Galactopyranosyl Glycerol | present | LOTUS | |
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| (3R,3'R,6S)-4,5-Didehydro-5,6-dihydro-beta,beta-carotene-3,3'-diol | present | NPASS |
05DNA & barcoding41 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lycium barbarum has left across the world's sequence archives.
At a glance
DNA specimens41
Marker genes7
GenBank sequences10
eDNA detections30
Countries7
The DNA barcodea real sequence read deposited for this species
GAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT …
Lycium barbarum isolate zcp-92 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL10★rbcLa★ITS★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Lycium barbarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 127 149 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lycium barbarum2.13 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–482n range24median24mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2427×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +7
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3350
CCDB · fl-europaea — Delay, 1967
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Cui, Q. h. & Y. z. Zhang. 1988. Analysis of karyotype of Lycium barbarum L. Acta Agric. Univ. Jilin. 10: 1–2.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1985. Chromosome observation of twenty species of drug plants in Xingjiang. Acta Bot. Boreal.-Occid. Sin. 5: 149–154.
CCDB · ipcn-api-dl — Bernardello, L. M. 1982. Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321–328.
CCDB · ipcn-api-dl — Ge, C. j. & Y. k. Li. 1989. Observation on the chromosome numbers of medicinal plants of Shandong Province (II). Chin. Traditional Herbal Drugs 20(6): 34–35.
CCDB · ipcn-api-dl — Ma, X. h., X. q. Ma & N. Li. 1990. Chromosome observation of some drug plants in Xinjiang. Acta Bot. Boreal.-Occid. Sin. 10: 203–210.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek, E. Hellmayr, J. Walter, J. Tschenett, C. Justin & M. Mann. 1991. Beiträge zur Flora von Österreich: Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 128: 19–39.
CCDB · ipcn-api-dl — Gao, L. & Z. Zhang. 1984. The chromosome numbers of some seed plants. Chin. Bull. Bot. 2(1): 43–44.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Zhao, D. l., H. m. Xu, Z. Hu & L. s. Wang. 2000. Karyotype analysis of Lycium barbarum L. of China. J. Lanzhou Univ., Nat. Sci. 26(6): 97–100.
CCDB · book-ipcn75-78 — Uhrikova 1976
CCDB · kew — Chen JC, Liu X, Zhu LC, Wang Y. 2013. Nuclear genome size estimation and karyotype analysis of Lycium species (Solanaceae). Scientia Horticulturae 151: 46-50.
CCDB · CromoCat 2015 — Badr, A., Khalifa, S. F., Aboel-Atta, A. I. & Abou-El-Enain, M. M. (1997). Chromosomal criteria and taxonomic relationships in the Solanaceae Cytologia 62: 103-113
CCDB · CromoCat 2015 — Bernardello, L. M. (1982). Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321-328
CCDB · CromoCat 2015 — Cui,/Q.-h. & Zhang, Y.-z. (1988). Analysis of karyotype of Lycium barbarum L. Acta Agriculturae Universitatis Jilinensis 10: 1-2
CCDB · CromoCat 2015 — Gao, L. & Zhang, Z. (1984). The chromosome numbers of some seed plants. Chinese Bulletin of Botany 2(1): 43-44.
CCDB · CromoCat 2015 — Ge, C.-J. & Li, Y.-K. (1989). Observation on the chromosome numbers of medicinal plants of Shandong Province (II). Chin. Tradit. Herbal Drugs 20: 34-35.
CCDB · CromoCat 2015 — Hindakova, M. (1976). Index of chromosome numbers of Slovakian flora. (Part 5). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1-18.
CCDB · CromoCat 2015 — Kiehn, M., Vitek, E., Hellmayr, E., Walter, J., Tschenett, J., Justin, C. & Mann, M. (1991). Beiträge zur Flora von Österreich: Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 128: 19-39
CCDB · CromoCat 2015 — Ma, X. H., Qin, R. L. & Xing, W. B. (1985). Chromosome observation of twenty species of drug plants in Xingjiang Acta Botanica Boreali-Occidentalia Sinica 5: 149-154
CCDB · CromoCat 2015 — Ma, X.-h., Ma, X.-q. & Li, N. (1990). Chromosome observation of some drug plants in Xinjiang. Acta Botanica Boreali-Occidentalia Sinica 10: 203-210
CCDB · CromoCat 2015 — Zhao, D.-l., H.-m. Xu, Z. Hu & L.-s. Wang. (2000). Karyotype analysis of Lycium barbarum L. of China Journal of Lanzhou University: Natural Sciences 26(6): 97-100
2n 484×CCDB · poland · CCDB · ipcn-api-dl · CCDB · CromoCat 2015 +1
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1971. Studies in chromosome numbers of Polish Angiosperms. Eighth contribution. Acta Biol. Cracov. Ser. Bot. 14, 55-102.
CCDB · ipcn-api-dl — Li, J., J. x. Wang, L. y. Wang & Z. m. Huang. 2001. New variety breeding of seedless Ningxia wolfberry. Acta Bot. Boreal.-Occid. Sin. 21(3): 446–450.
CCDB · CromoCat 2015 — Li, J., Wang, J. x., Wang, L. y. & Huang, Z. m. (2001). New variety breeding of seedless Ningxia wolfberry. Acta Bot. Boreal.-Occid. Sin. 21(3): 446–450.
TreeOfSex · plant — Goldblatt1979 ↗
2n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bernardello, L. M. (1982). Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321-328
n 125×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · solan
CCDB · ipcn-api-dl — Bernardello, L. M. 1982. Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321–328.
CCDB · book-ipcn67-71 — DELAY, J. 1967. Halophytes. Inf. Ann. Caryosyst. et Cytogenet. 1: 11-14.
CCDB · CromoCat 2015 — Bernardello, L. M. (1982). Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321-328
n 1122×CCDB · CromoCat 2015 · TreeOfSex · plant
CCDB · CromoCat 2015 — Bernardello, L. M. (1982). Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321-328
TreeOfSex · plant — Goldblatt1979|venter2000|bernardello1986 ↗
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Li, J., Wang, J. x., Wang, L. y. & Huang, Z. m. (2001). New variety breeding of seedless Ningxia wolfberry. Acta Bot. Boreal.-Occid. Sin. 21(3): 446–450.
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bernardello, L. M. (1982). Estudios en Lycium (Solanaceae) II. Recuentos cromosómicos en entidades Argentinas. Hickenia 1: 321-328
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.9% BUSCO
08Occurrence & distribution
Record type34 960 records
Wild obs. + sensor32 414
Museum / vouchered2 465
Cultivated / captive21
Other60
Origin
Native19
Introduced285
Range
Area of Occupancy AOO59 716 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 10 843≤1 km 4 564≤10 km 12 003>10 km 118
27 528 georeferenced · 4 886 without coordinates
Open the mapobservation + sensor32 414
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 144≤1 km 365≤10 km 709>10 km 59
1 277 georeferenced · 1 188 without coordinates
Open the institutions mapphysical evidence2 465
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 1≤10 km 3>10 km 11
15 georeferenced · 6 without coordinates
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions125 of 210 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 366 |
| LDlocation not on record | 138 |
| Beijing, CN | 99 |
| MeiseBGlocation not on record | 95 |
| SLU Artdatabankenlocation not on record | 71 |
| Yangling, CN | 70 |
| Moscow State Universitylocation not on record | 62 |
| Oskarshamn, SE | 54 |
| Uniwersytet Warszawskilocation not on record | 36 |
| Uppsala, SE | 34 |
| Wuzhou, CN | 33 |
| Bronx, US | 32 |
| Chongqing Museumlocation not on record | 30 |
| South Kensington, GB | 26 |
| Kunming, CN | 25 |
| Olocation not on record | 24 |
| Museo Entomologico de Leonlocation not on record | 24 |
| Pullman, US | 22 |
| Görlitz, DE | 20 |
| Adelaide, AU | 20 |
| Baroda, IN | 18 |
| Mount Annan, AU | 18 |
| BFLlocation not on record | 17 |
| Dresden, DE | 17 |
| Berlin, DE | 16 |
| Chengdu, CN | 16 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 16 |
| University of Stellenboschlocation not on record | 15 |
| MAlocation not on record | 14 |
| KMNlocation not on record | 14 |
| Mlocation not on record | 14 |
| Bern, CH | 13 |
| Saint Louis, US | 13 |
| Karlsruhe, DE | 13 |
| Denver, US | 12 |
| Davis, US | 11 |
| Auckland, NZ | 11 |
| Bloomington, US | 11 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 10 |
| Jiangxi College of Educationlocation not on record | 10 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 10 |
| Christchurch, NZ | 9 |
| Provo, US | 9 |
| WTUlocation not on record | 9 |
| Xining, CN | 9 |
| BIO-UNIPIlocation not on record | 9 |
| Logan, US | 9 |
| Philadelphia, US | 8 |
| Ann Arbor, US | 8 |
| Canberra, AU | 8 |
| Claremont, US | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Brussel, BE | 8 |
| Chengdu, CN | 8 |
| Brisbane, AU | 8 |
| Burlington, US | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Chadron, US | 7 |
| Provincia di Livornolocation not on record | 7 |
| Guangzhou, CN | 7 |
| Madison, US | 7 |
| Pamplona, ES | 7 |
| Vitoria, ES | 7 |
| Salzburg, AT | 6 |
| Vancouver, CA | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| BRNUlocation not on record | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Lanzhou, CN | 6 |
| Wlocation not on record | 6 |
| St. Paul, US | 6 |
| Inner Mongolia Universitylocation not on record | 6 |
| Toronto, CA | 5 |
| BClocation not on record | 5 |
| IDElocation not on record | 5 |
| College Park, US | 5 |
| GJOlocation not on record | 5 |
| Trondheim, NO | 5 |
| Hobart, AU | 5 |
| Chapel Hill, US | 5 |
| Wellington, NZ | 5 |
| Albuquerque, US | 5 |
| Madrid, ES | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 4 |
| San Diego, US | 4 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| Wuhan, CN | 4 |
| Armidale, AU | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Riverside, US | 4 |
| Beijing, CN | 4 |
| València, ES | 4 |
| Adam Mickiewicz University in Poznańlocation not on record | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Orem, US | 4 |
| CASlocation not on record | 4 |
| Corvallis, US | 3 |
| Córdoba, AR | 3 |
| Frankfurt am Main | 3 |
| SZUlocation not on record | 3 |
| Dekalb, US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| Shanxi Universitylocation not on record | 3 |
| San Jose, US | 3 |
| Frauenfeld, CH | 3 |
| Flagstaff, US | 3 |
| Paris, FR | 3 |
| Arcata, US | 3 |
| DBF-NHMDlocation not on record | 3 |
| Durham, US | 3 |
| Nanjing, CN | 3 |
| Pamplona, ES | 3 |
| Spearfish, US | 3 |
| Fort Worth, US | 3 |
| Missoula, US | 3 |
| Bourges, FR | 3 |
| McWane Science Centerlocation not on record | 3 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Zürich, CH | 2 |
| Santa Barbara, US | 2 |
| Boise, US | 2 |
| Grand Junction, US | 2 |
| Fayetteville, US | 2 |
| Seoul, KR | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Bangkok, TH | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Columbia, US | 2 |
| Millersville, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| EMTCMlocation not on record | 2 |
| Xian, CN | 2 |
| Lincoln, US | 2 |
| Acadia Universitylocation not on record | 2 |
| Tilburg, NL | 2 |
| Caldwell, US | 2 |
| Salamanca, ES | 2 |
| Guangzhou, CN | 2 |
| Nanjing, CN | 2 |
| Norfolk, US | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Rotorua, NZ | 2 |
| Nijmegen, NL | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Moscow, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Durango, US | 2 |
| Sevilla, ES | 2 |
| NMBU:MINAlocation not on record | 2 |
| Barcelona, ES | 2 |
| H-AkrKGlocation not on record | 1 |
| Kew, GB | 1 |
| ASUlocation not on record | 1 |
| GMBAlocation not on record | 1 |
| Castelar, AR | 1 |
| Pittsburg, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Tartu, EE | 1 |
| Clemson, US | 1 |
| Córdoba, ES | 1 |
| Northridge, US | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| H-Hohlalocation not on record | 1 |
| Kingston, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| NoColllocation not on record | 1 |
| Springfield, US | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Fairfax, US | 1 |
| GAlocation not on record | 1 |
| Xiamen, CN | 1 |
| Tallinn, EE | 1 |
| Universität Göttingenlocation not on record | 1 |
| Springfield, US | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| EL PASO, US | 1 |
| Chicago, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Emporia, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Jaén, ES | 1 |
| Nanjing, CN | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Sion, CH | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Williamsburg, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Macomb, US | 1 |
| IMMUlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Phoenix, US | 1 |
| PRClocation not on record | 1 |
| Madrid, ES | 1 |
| BG-NMNHSlocation not on record | 1 |
| Wuhan, CN | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Boumlocation not on record | 1 |
| Los Angeles, US | 1 |
210 institutions · 2 104 of 2 465 vouchered records shown · 339 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA30 detections
Where the DNA of Lycium barbarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.3 °C 12.4–23.7
Seasonal swing summer↔winter15.1 °C
Max temp (day)20.9 °C 14.3–29.2
Min temp (night)13.5 °C 10.1–17.0
Precipitation86.2 mm/mo 26.7–101
Air humidity61.2 % 43.9–63.5
Moisture balance-1.60 mm/mo -127–18.5
Vapour deficit775 Pa 545–1,582
Wind speed3.90 m/s 1.80–4.70
Cloud cover41.6 % 31.5–45.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.