Lycaena dispar

(Haworth, 1803) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Lycaena

At a glance

Occurrence records40 082

Data sources9

Biological traits2

DNA specimens371

eDNA detections143

Sources9 archives

Databases and archives Lycaena dispar's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 082 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI143 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics371 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF40 082 records

Environmental DNA1 datasets · 22 countries143 detections

DNA & barcodingBOLD371 specimens

Genome at a glanceNCBI≈484 Mbp

01Narrative

The large copper (Lycaena dispar) is a butterfly of the family Lycaenidae. L. dispar has been commonly arranged into three subspecies: L. dispar dispar, (single-brooded) which was commonly found in England, but is now extinct, L. d. batavus, (single-brooded) can be found in the Netherlands and has been reintroduced into the United Kingdom, and lastly, L. d. rutilus, (double-brooded) which is widespread across central and southern Europe. The latter has been declining in many European countries, due to habitat loss. Currently L. dispar is in severe decline in northwest Europe, but expanding in central and northern Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding371 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lycaena dispar has left across the world's sequence archives.

At a glance

DNA specimens371

BINs4

Marker genes15

eDNA detections143

Countries24

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus156 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

10Tvariable

40Tvariable

82Cvariable

118Tvariable

205Cvariable

316Gvariable

340Tvariable

412Gvariable

418Cvariable

439Tvariable

512Avariable

513Gvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGAATTTTAATTCGTCTTGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes9

BINs4

Most divergent pair2.3%

AsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hyrcanana sarthasame family4.3%Lycaena virgaureaesame genus4.4%Hyrcanana caspiussame family4.6%Lycaena bleuseisame genus4.9%Lycaena asabinussame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND612SMT-NADH5

animal barcoderibosomalmitochondrialmarker

06Genome at a glanceNCBI

The complete instruction manual Lycaena dispar carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈484 250 665 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lycaena dispar0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type40 082 records

Wild obs. + sensor37 911

Museum / vouchered2 024

Cultivated / captive129

Other18

Origin

Native898

Range

Area of Occupancy AOO57 900 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 5 674≤1 km 2 661≤10 km 23 234>10 km 845

32 414 georeferenced · 5 497 without coordinates

Open the mapobservation + sensor37 911

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 1 313≤1 km 171≤10 km 119>10 km 14

1 617 georeferenced · 407 without coordinates

Open the institutions mapphysical evidence2 024

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 129 records without

Open the mapnot free-living129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	1 333
South Kensington, GB	93
Muzeum Górnośląskie w Bytomiulocation not on record	78
Tartu, EE	73
Adam Mickiewicz University in Poznańlocation not on record	34
Philadelphia, US	34
NMOKlocation not on record	30
Nijmegen, NL	20
Provincia di Livornolocation not on record	20
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	19
Paro, BT	14
Sanda, JP	14
Tallinn, EE	13
Podgorica, ME	12
Salzburg, AT	9
John May Museum of Natural Historylocation not on record	8
NSMKlocation not on record	7
Helsinki, FI	6
MZLUlocation not on record	5
HUNMlocation not on record	5
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
New Haven, US	4
Musee d'Histoire Naturallelocation not on record	4
MJINlocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
Auckland, NZ	2
Geneva, CH	2
ZSMlocation not on record	2
Archäologie und Museum Baselland - Museum.BLlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
NCMGlocation not on record	1
DNSMlocation not on record	1

33 institutions · 1 858 of 2 024 vouchered records shown · 166 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA143 detections

Where the DNA of Lycaena dispar was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found143

Studies independent surveys1

Countries22

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 143 detections have coordinates

Open the map22 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 9.00–19.1

Seasonal swing summer↔winter20.6 °C

Max temp (day)19.1 °C 12.7–23.7

Min temp (night)10.5 °C 5.00–14.3

Precipitation64.3 mm/mo 46.4–106

Air humidity60.8 % 56.3–63.4

Moisture balance-22.2 mm/mo -69.3–-7.70

Vapour deficit722 Pa 505–940

Wind speed3.20 m/s 2.20–4.50

Cloud cover40.1 % 34.4–43.9

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lycaena dispar

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type40 082 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type40 082 records