Luxiaria mitorrhaphes

Prout, 1925 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Luxiaria

At a glance

Occurrence records732

Data sources8

Biological traits0

DNA specimens18

eDNA detections38

Sources8 archives

Databases and archives Luxiaria mitorrhaphes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI38 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF732 records

Environmental DNA1 datasets · 10 countries38 detections

DNA & barcodingBOLD18 specimens

01Narrative

Luxiaria mitorrhaphes is a moth in the family Geometridae first described by Louis Beethoven Prout in 1925. It is found from the Himalayas to Japan, Taiwan, Myanmar, Borneo and Java. Males are uniform fawn, while females are more speckled and have darker zones distal to the postmedials.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Luxiaria mitorrhaphes has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections38

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

7Amostly conserved

8Tmostly conserved

9Amostly conserved

10Tmostly conserved

40Cmostly conserved

106Cmostly conserved

190Amostly conserved

352Amostly conserved

421Tmostly conserved

442Cmostly conserved

468Gmostly conserved

619Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTCGGTACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes5

BIN1

Most divergent pair0.91%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Luxiaria cestinotasame genus5.3%Luxiaria subrasatasame genus5.6%Luxiaria emphaticasame genus5.9%Luxiaria phyllosariasame genus6.8%Scionomia anomalasame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_061239 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type732 records

Wild obs. + sensor354

Museum / vouchered378

Range

Area of Occupancy AOO904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 19≤1 km 19≤10 km 2>10 km 5

45 georeferenced · 309 without coordinates

Open the mapobservation + sensor354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence378

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	213
FACTlocation not on record	80
Taiwan Forestry Research Institutelocation not on record	69
ZSMlocation not on record	6
Denver, US	4
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	3

6 institutions · 375 of 378 vouchered records shown · 3 without an institution code

09Environmental DNA38 detections

Where the DNA of Luxiaria mitorrhaphes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found38

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 38 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 12.1–25.1

Seasonal swing summer↔winter9.90 °C

Max temp (day)22.1 °C 16.3–27.6

Min temp (night)14.9 °C 7.60–21.0

Precipitation249 mm/mo 87.7–435

Air humidity68.5 % 64.8–73.0

Moisture balance141 mm/mo -1.10–312

Vapour deficit650 Pa 422–1,085

Wind speed1.60 m/s 1.20–2.30

Cloud cover47.4 % 28.2–64.1

CHELSA 1981–2010, ~9 km grid, at location & month of 30 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)