Lupinus polyphyllus
Lindl. · speciesAt a glance
Occurrence records266 880
Data sources14
Biological traits56
DNA specimens60
eDNA detections42
Sources14 archives
Databases and archives Lupinus polyphyllus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility266 880 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics60 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources56 traits
Chemical compositionLOTUS · NPASS71 compounds
Occurrence & distributionGBIF266 880 records
Environmental DNA1 datasets · 4 countries42 detections
DNA & barcodingBOLD · NCBI60 specimens
Genome at a glanceCCDB · GoaT807 Mbp
01Narrative
Lupinus polyphyllus, le Lupin des jardins ou Lupin à folioles nombreuses, est une espèce de plantes à fleurs originaire de l’ouest de l’Amérique du Nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology21
Fruit length32.5 mm
⚠ sources differ — AusTraits: 32.5 mm · GIFT: 40 mm
Fruit width9 mm
Leaf length100 mm
Leaf length max150 mm
Leaf length min50 mm
Leaf mass1 181 mg
Leaf size19 778 mm²
Leaf width20 mm
Leaf width max30 mm
Leaf width min10 mm
Petiole length25 cm
Plant height1.09 m
⚠ sources differ — GIFT: 1.09 m · AusTraits: 1.5 m · LEDA: 1.18 m · TRY: 1.5 m
Plant height generative0.86 m
Plant height max1.5 m
Plant height min0.5 m
Seed length4.47 mm
⚠ sources differ — TRY: 4.47 mm · AusTraits: 4 mm · GIFT: 2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass21.73 mg
⚠ sources differ — TRY: 21.73 mg · LEDA: 25 mg · GIFT: 22.15 mg
Seed mass max28.3 mg
Seed mass min14.72 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeself
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 078
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min500 m
Epiphyteterrestrial
Fruit typelegume
⚠ sources differ — AusTraits: legume · GIFT: capsule
Growth formherb
Habitat GIFTgarden
Leaf compoundnesscompound
Leaf shapelanceolate obovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)171 mg/g
Leaf n32.0 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)29.41 mm²/mg
⚠ sources differ — TRY: 29.41 mm²/mg · LEDA: 23.32 mm²/mg · GIFT: 23.19 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition71 compounds
Compounds documented for Lupinus polyphyllus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Quinolizidine alkaloids42
Isoflavones9
Flavones7
Kaurane and Phyllocladane diterpenoids3
Pyridine alkaloids $ Quinolizidine alkaloids2
Documented compounds71 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Lupanine | present | LOTUS | |
| (-)-Sandaracopimaric acid | present | NPASS | |
| (1R,2R,9R,10S)-6-oxo-10-prop-2-enyl-7,11-diazatricyclo[7.3.1.02,7]tridecane-11-carbaldehyde | present | LOTUS | |
| (1R,2R,9R,10S,12R)-12-hydroxy-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one | present | LOTUS | |
| (1R,2R,9R,10S,12S)-12-methoxy-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one | present | LOTUS | |
| (1R,2R,9R,12R)-12-Prop-2-enyl-7,11-diazatricyclo[7.3.1.02,7]tridec-5-en-4-one | present | LOTUS | |
| (1R,2R,9S)-11-but-3-enyl-7,11-diazatricyclo[7.3.1.02,7]tridec-5-en-4-one | present | LOTUS | |
| (1R,2R,9S,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one | present | LOTUS | |
| (1S,2R,9R,10S)-6-oxo-10-prop-2-enyl-7,11-diazatricyclo[7.3.1.02,7]tridecane-11-carbaldehyde | present | LOTUS | |
| (1S,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-5-en-4-one | present | LOTUS |
05DNA & barcoding60 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lupinus polyphyllus has left across the world's sequence archives.
At a glance
DNA specimens60
Marker genes7
GenBank sequences10
eDNA detections42
Countries6
The DNA barcodea real sequence read deposited for this species
ACCCCGTGAATTTGTTTTACTACTCAGGGGTGGCTAGAGGTGTTTGGCACCTCGGTCCCCCTCGTGTCAGGAGGCGCCACATCCTGTGCG …
Lupinus polyphyllus isolate LV2c internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Lupinus polyphyllus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size806 850 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lupinus polyphyllus0.81 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy4× tetraploid · measured
Chromosome records48–962n range48median48mode35records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4832×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2994
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Carniel, K. 1979. Band-like structures in the chromocentres of Lupinus polyphyllus. Pl. Syst. Evol. 131: 235–242.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Izmai|1low, R. 1989. Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · book-ipcn75-78 — Uhrikova 1974b
CCDB · book-ipcn75-78 — Uhrikova 1974a
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-fedorov — CaB'Ieuxo 19356
CCDB · book-fedorov — TymuJmoBa 1935
CCDB · book-fedorov — Cooper D. C. 1936a
CCDB · book-fedorov — Bragdo 1957
CCDB · book-fedorov — Phillips L. L. 1957
CCDB · book-fedorov — Berger C. A. et al. 1958
CCDB · book-fedorov — AtagekoBa 1962
CCDB · book-fedorov — Gustafsson, Gadd 1965
CCDB · book-fedorov — Snow 1959
CCDB · book-atlas-flowering-plants — Cooper 1936
CCDB · kew — Naganowska B, Wolko B, Sliwinska E, Kaczmarek Z, Schifino-Wittmann M. 2006. 2C DNA variation and relationships among New World species of the genus Lupinus (Fabaceae). Plant Systematics and Evolution 256: 147-157.
CCDB · Cave1957 — Bragd
CCDB · CromoCat 2015 — Izmailow, R. (1989). Further studies in chromosome numbers of Polish angiosperms. Part XXII. Acta Biol. Cracov., Ser. Bot. 31: 1-17.
CCDB · CromoCat 2015 — Murín, A. (1993). Karyologické štúdium okrasnych rastlín flóry Slovenska. Biologia 48: 441-445.
CCDB · CromoCat 2015 — Pogan, E., A. Jankun & Z. Sawicka (1990). Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1-17.
CCDB · CromoCat 2015 — Rudyka, E. G. (1986). Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Žurn. 71: 1426-1427.
CCDB · CromoCat 2015 — Semerenko, L. V. (1989). Chisla khromosom nekotorykh pretstavitelei semeistv Asteraceae, Fabaceae, Orchidaceae, Poaceae flory Berezinskogo Biosfernogo Zapovednika (BSSR). Bot. Žurn. 74(11): 1671-1673.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 963×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Taylor, R. L. & S. Taylor. 1977. Chromosome numbers of vascular plants of British Columbia. Syesis 10: 125–138.
CCDB · book-ipcn75-78 — Taylor & Taylor 1977
CCDB · CromoCat 2015 — Taylor, R. L. & S. Taylor (1977). Chromosome numbers of vascular plants of British Columbia Syesis 10: 125–138
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
n 246×CCDB · iapt · CCDB · Cannon, 2015 · CCDB · Cave1957 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · Cannon, 2015 — Naganowska et al., 2006
CCDB · Cave1957 — Phillips
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.861 ↗
08Occurrence & distribution
Record type266 880 records
Wild obs. + sensor263 530
Museum / vouchered2 867
Cultivated / captive170
Other313
Origin
Native85
Introduced676
Range
Area of Occupancy AOO332 276 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 169 257≤1 km 50 703≤10 km 21 338>10 km 1 130
242 428 georeferenced · 21 102 without coordinates
Open the mapobservation + sensor263 530
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 309≤1 km 409≤10 km 841>10 km 144
1 703 georeferenced · 1 164 without coordinates
Open the institutions mapphysical evidence2 867
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤1 km 1≤10 km 6
7 georeferenced · 163 without coordinates
Open the mapnot free-living170
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions109 of 188 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 441 |
| BFLlocation not on record | 149 |
| Helsinki, FI | 100 |
| TROMlocation not on record | 94 |
| LDlocation not on record | 91 |
| Olocation not on record | 83 |
| Pullman, US | 78 |
| Bozeman, US | 70 |
| Trondheim, NO | 68 |
| WTUlocation not on record | 65 |
| Moscow, US | 59 |
| KMNlocation not on record | 56 |
| Moscow State Universitylocation not on record | 49 |
| SLU Artdatabankenlocation not on record | 45 |
| Victoria, CA | 44 |
| Uniwersytet Warszawskilocation not on record | 38 |
| Christchurch, NZ | 36 |
| Madison, US | 35 |
| Salzburg, AT | 33 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 32 |
| Bergen, NO | 32 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 31 |
| Tartu, EE | 30 |
| Görlitz, DE | 30 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| Portland, US | 26 |
| Chicago, US | 24 |
| Provo, US | 22 |
| Oulu, FI | 22 |
| Acadia Universitylocation not on record | 21 |
| Museo Entomologico de Leonlocation not on record | 21 |
| Mlocation not on record | 20 |
| Oskarshamn, SE | 19 |
| Davis, US | 16 |
| Saint John, CA | 16 |
| Boise, US | 16 |
| Provincia di Livornolocation not on record | 16 |
| MeiseBGlocation not on record | 14 |
| Pocatello, US | 13 |
| Karlsruhe, DE | 12 |
| Saint Louis, US | 11 |
| Bronx, US | 11 |
| Jyväskylä, FI | 11 |
| Uppsala, SE | 11 |
| Tacoma, US | 10 |
| Cheney, US | 10 |
| University of Wisconsinlocation not on record | 10 |
| Canberra, AU | 9 |
| Angwin, US | 9 |
| Kuopio, FI | 9 |
| Anchorage, US | 9 |
| Riverside, US | 9 |
| Arcata, US | 8 |
| Corvallis, US | 8 |
| Wellington, NZ | 8 |
| Mount Annan, AU | 8 |
| Xiamen, CN | 8 |
| Montréal, CA | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Québec, CA | 7 |
| Claremont, US | 7 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Otaru, JP | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| US | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Tula State Universitylocation not on record | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Turku, FI | 6 |
| Toronto, CA | 5 |
| Turlock, US | 5 |
| Auckland, NZ | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| University of New Hampshirelocation not on record | 5 |
| Barcelona, ES | 5 |
| TUR-Alocation not on record | 5 |
| BRNUlocation not on record | 5 |
| Logan, US | 5 |
| Missoula, US | 5 |
| Tallinn, EE | 5 |
| Philadelphia, US | 5 |
| Bern, CH | 4 |
| Bangkok, TH | 4 |
| Flagstaff, US | 4 |
| Ann Arbor, US | 4 |
| San Diego, US | 4 |
| nbflocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Université Lavallocation not on record | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| Frankfurt am Main | 4 |
| Córdoba, AR | 3 |
| ASUlocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| CZE090location not on record | 3 |
| CJBNlocation not on record | 3 |
| US | 3 |
| San Jose, US | 3 |
| Beijing, CN | 3 |
| Voronezh State Universitylocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| South Kensington, GB | 3 |
| Berlin, DE | 3 |
| San Luis Obispo, US | 3 |
| Chicago, US | 3 |
| Denver, US | 3 |
| Kew, GB | 2 |
| ROM007location not on record | 2 |
| Rotorua, NZ | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| GZUlocation not on record | 2 |
| Castelar, AR | 2 |
| LISUlocation not on record | 2 |
| San Isidro, AR | 2 |
| Armidale, AU | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| CASlocation not on record | 2 |
| València, ES | 2 |
| DBF-NHMDlocation not on record | 2 |
| College Park, US | 2 |
| Garðabær, IS | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Porvoo, FI | 2 |
| Grand Junction, US | 2 |
| Albuquerque, US | 2 |
| Northridge, US | 2 |
| NBSIlocation not on record | 2 |
| Santa Cruz, US | 2 |
| Durango, US | 2 |
| McWane Science Centerlocation not on record | 1 |
| Kunming, CN | 1 |
| Columbia, US | 1 |
| Spearfish, US | 1 |
| San Angelo, US | 1 |
| San Francisco, US | 1 |
| Philadelphia, US | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Clemson, US | 1 |
| EL PASO, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Parkville, AU | 1 |
| Brisbane, AU | 1 |
| ROM020location not on record | 1 |
| Whitewater, US | 1 |
| PrivatHerblocation not on record | 1 |
| SZUlocation not on record | 1 |
| Pittsburg, US | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| HUN003location not on record | 1 |
| H-Diewaldlocation not on record | 1 |
| GB | 1 |
| Bend, US | 1 |
| Tilburg, NL | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| FLASlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Porto Alegre, BR | 1 |
| Green Bay, US | 1 |
| Whitehorse, CA | 1 |
| Ashland, US | 1 |
| Portland, US | 1 |
| Stockholm, SE | 1 |
| INFlocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Tromso University Museumlocation not on record | 1 |
| Hudson, US | 1 |
| Sapporo, JP | 1 |
| Ypsilanti, US | 1 |
| Adelaide, AU | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| KNFSClocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Tampa, US | 1 |
188 institutions · 2 594 of 2 867 vouchered records shown · 176 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA42 detections
Where the DNA of Lupinus polyphyllus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found42
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 42 detections have coordinates
Open the map4 countries0
Dry roadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.5 °C 9.40–19.4
Seasonal swing summer↔winter23.4 °C
Max temp (day)19.2 °C 11.8–24.6
Min temp (night)11.6 °C 5.20–15.5
Precipitation79.6 mm/mo 56.6–89.4
Air humidity59.5 % 58.0–64.9
Moisture balance-38.6 mm/mo -68.5–18.5
Vapour deficit728 Pa 426–910
Wind speed3.30 m/s 2.00–4.10
Cloud cover40.5 % 38.0–57.1
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.