Lupinus mutabilis

Sweet · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Lupinus

At a glance

Occurrence records496

Data sources14

Biological traits18

DNA specimens15

eDNA detections15

Sources14 archives

Databases and archives Lupinus mutabilis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility496 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS · NPASS63 compounds

Occurrence & distributionGBIF496 records

Environmental DNA1 datasets · 0 countries15 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB · GoaT929 Mbp

01Narrative

Lupinus mutabilis is a species of lupin grown in the Andes, mainly for its edible bean. Vernacular names include tarwi (in Quechua II, pronounced tarhui), chocho, altramuz, Andean lupin, South American lupin, Peruvian field lupin, and pearl lupin. Its nutrient-rich seeds are high in protein, as well as a good source for cooking oil. However, their bitter taste has made L. mutabilis relatively unknown outside the Andes, though modern technology makes it easier to remove the bitter alkaloids. Like other species of lupin beans, it is expanding in use as a plant-based protein source.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1.5 m

Life cycle & reproduction5

Life formannual, perennial or subshrub

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max3 000 m

Elevation min1 700 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Shrub

Mycorrhiza typearbuscular

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: variable

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition63 compounds

Compounds documented for Lupinus mutabilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Quinolizidine alkaloids17

Spirostane steroids10

Pyridine alkaloids $ Quinolizidine alkaloids4

Isoflavones4

Furostane steroids3

Documented compounds63 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dioscin	present	NPASS
(+)-Lupanine	present	LOTUS
(+)-Thermopsine	present	LOTUS
(1R,2R,4S,6S,7S,8R,9S,12S,13S,15S,16S,18R)-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,15,16-triol	present	NPASS
(1R,2R,4S,6S,7S,8R,9S,12S,13S,15S,16S,18R)-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,15,16-triol	present	NPASS
(1R,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1R,2R,9S,10R)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadecan-6-one	present	LOTUS
(1S,2R,4R,5'R,6R,7S,8R,9S,12R,13S,15R,16R,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-15,16-diol	present	NPASS
(1S,2R,9R,10S)-7,15-diazatetracyclo[7.7.1.02,7.010,15]heptadec-5-en-4-one	present	LOTUS
(1S,2S,4R,5'R,6R,7R,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-ol	present	NPASS

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lupinus mutabilis has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences10

eDNA detections15

The DNA barcodea real sequence read deposited for this species

ITSDQ524269.1 ↗593 bp

ACGT

TCGAAGCCTCACAAGCAGTGCGACCCCGTGAATTTGTTTTACTACTCAGGGGTGGCTAGAGGTGTTTGGCACCTCGGCCCCCCTCGTGTC …

Lupinus mutabilis isolate CEH 2280 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Lupinus mutabilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size929 100 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lupinus mutabilis0.93 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidy2× diploid · measured

Chromosome records42–482n range48median48mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4814×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Elementos para o estudo citolgico do gnero Lupinos. Malheiros-Gard, N.Agron. Lusit.4(3): 231-236(1942).

CCDB · ipcn-api-dl — 2006. Chromosome numbers in South American Andean species of Lupinus (Leguminosae). Bonplandia (Corrientes) 15(3–4): 113–119.

CCDB · ipcn-api-dl — Naganowska, B., B. Wolko, E. S|4liwińska & Z. Kaczmarek. 2003. Nuclear DNA content variation and species relationships in the genus Lupinus (Fabaceae). Ann. Bot. (Oxford) 92: 349–355.

CCDB · book-fedorov — Winge 1925

CCDB · book-fedorov — CaB'IeHKO 19356

CCDB · book-fedorov — TymHJIKoBa 1935

CCDB · book-fedorov — Malheiros 191-:!

CCDB · book-fedorov — AtagekoBa 1959a, 1962

CCDB · book-fedorov — Heiser 1963a (I. 1963)

CCDB · book-fedorov — Gustafsson, Gadd 1965

CCDB · book-atlas-flowering-plants — Mallieiros 1942

CCDB · kew — Naganowska B, Wolko B, Sliwinska E, Kaczmarek Z. 2003. Nuclear DNA content variation and species relationships in the genus Lupinus (Fabaceae). Annals of Botany 92: 349-355.

2n 421×CCDB · book-fedorov

CCDB · book-fedorov — Milovidov 1926

n 242×CCDB · Cannon, 2015 · CCDB · Cave1963

CCDB · Cannon, 2015 — Naganowska et al., 2003

CCDB · Cave1963 — Heiser 1963a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.861 ↗

08Occurrence & distribution

Record type496 records

Wild obs. + sensor118

Museum / vouchered79

Cultivated / captive151

Other148

Origin

Native127

Introduced10

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 58≤1 km 25≤10 km 6>10 km 2

91 georeferenced · 27 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 2≤10 km 7>10 km 5

14 georeferenced · 65 without coordinates

Open the institutions mapphysical evidence79

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy1% within 1 km

≤1 km 1≤10 km 1>10 km 87

89 georeferenced · 62 without coordinates

Open the mapnot free-living151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	14
LDlocation not on record	7
Bloomington, US	5
Universidad de La Salle (La Salle)location not on record	5
Bronx, US	3
Universidad Nacional de Colombia (UNAL)location not on record	3
Universidad de Caldas (UCaldas)location not on record	3
Tampa, US	2
Xiamen, CN	2
Aarhus, DK	2
QCNElocation not on record	2
Loja, EC	2
UTPLlocation not on record	2
Chicago, US	2
Edinburgh, GB	2
Museo Entomologico de Leonlocation not on record	1
Mount Annan, AU	1
Görlitz, DE	1
Cambridge, US	1
Universidad Privada Antenor Orregolocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
MAlocation not on record	1
Sucre, BO	1
Universidad de Antioquia (UdeA)location not on record	1
Brasília, BR	1
Vancouver, CA	1
La Paz, BO	1
Bern, CH	1
Elocation not on record	1
Riobamba, EC	1
Quito, EC	1
Istituto Agrario Castelnuovolocation not on record	1
Mlocation not on record	1
Voronezh State Universitylocation not on record	1

34 institutions · 75 of 79 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Lupinus mutabilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)