Lucilia bufonivora

Moniez, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Calliphoridae/Lucilia

At a glance

Occurrence records982

Data sources7

Biological traits1

DNA specimens21

eDNA detections22

Sources7 archives

Databases and archives Lucilia bufonivora's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility982 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF982 records

Environmental DNA2 datasets · 7 countries22 detections

DNA & barcodingBOLD21 specimens

01Narrative

Die Krötengoldfliege (Lucilia bufonivora), auch Krötenfliege genannt, ist eine unter anderem auch in Mitteleuropa vorkommende Art aus der Familie der Schmeißfliegen (Calliphoridae). Mehrere Arten der Gattung Lucilia sind fakultative (wahlweise) oder obligate (ausschließliche) Parasitoide von Amphibien. Die Larven der Krötengoldfliege gehören zu der letztgenannten Gruppe. Sie fressen das innere Gewebe insbesondere im Kopfbereich von lebenden Kröten oder anderen Lurchen, bis diese sterben und die Maden schließlich im Boden zur Verpuppung gelangen. Dieser Befall von lebendem Wirbeltiergewebe mit Fliegenmaden wird – unabhängig von der Wirtsart – als MyiasisF. Zumpt: Myiasis in man and animals in the old world: a textbook for physicians, veterinarians and zoologists - London, 1965, (Butterworths)(Fliegenmadenkrankheit) bezeichnet.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)parasitoid

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lucilia bufonivora has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections22

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 33 variable positions, in barcode order

4Tmostly conserved

7Amostly conserved

16Tmostly conserved

22Amostly conserved

31Cmostly conserved

40Tmostly conserved

59Amostly conserved

88Amostly conserved

106Tmostly conserved

163Gmostly conserved

193Tmostly conserved

202Cmostly conserved

212Cmostly conserved

220Tmostly conserved

235Cmostly conserved

238Cmostly conserved

271Cmostly conserved

298Tmostly conserved

361Cmostly conserved

407Tmostly conserved

412Amostly conserved

433Gmostly conserved

448Cmostly conserved

518Amostly conserved

526Amostly conserved

562Cmostly conserved

595Cmostly conserved

601Tmostly conserved

604Amostly conserved

619Tmostly conserved

622Gmostly conserved

634Cmostly conserved

643Amostly conserved

AACTTTATACTTTATTTTTGGAGCTTGATCCGGAATAATTGGAACTTCTTTAAGAATTATAATTCGAGCTGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.2%

Haplotypes3

BINs2

Most divergent pair14.4%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lucilia magnicornissame genus3.4%Lucilia sericatasame genus3.5%Lucilia cuprinasame genus3.8%Lucilia elongatasame genus4.0%Lucilia silvarumsame genus4.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type982 records

Wild obs. + sensor860

Museum / vouchered116

Cultivated / captive5

Other1

Range

Area of Occupancy AOO2 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 165≤1 km 47≤10 km 586>10 km 2

800 georeferenced · 60 without coordinates

Open the mapobservation + sensor860

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 35≤1 km 30≤10 km 23>10 km 2

90 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence116

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	32
South Kensington, GB	17
KwaZulu-Natal Museumlocation not on record	8
SLU Artdatabankenlocation not on record	7
DFFW2018location not on record	3
University of Tokyo, Department of Zoologylocation not on record	3
Gothenburg, SE	3
University of Guelphlocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
DFFW2016location not on record	1
Tilburg, NL	1
NCMGlocation not on record	1
ZMAAlocation not on record	1

13 institutions · 81 of 116 vouchered records shown · 34 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA22 detections

Where the DNA of Lucilia bufonivora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys2

Countries7

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map7 countries0

4. Native GrasslandGrassland14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 12.2–19.2

Seasonal swing summer↔winter20.1 °C

Max temp (day)21.1 °C 15.2–23.4

Min temp (night)13.0 °C 7.90–14.4

Precipitation82.4 mm/mo 57.6–95.8

Air humidity58.2 % 53.9–61.3

Moisture balance-46.9 mm/mo -61.7–22.4

Vapour deficit816 Pa 587–953

Wind speed2.60 m/s 2.00–4.50

Cloud cover38.3 % 35.1–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)