Lozotaeniodes formosana

(Frölich, 1830) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Lozotaeniodes

At a glance

Occurrence records7 234

Data sources6

Biological traits2

DNA specimens15

eDNA detections0

Sources6 archives

Databases and archives Lozotaeniodes formosana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 234 records↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 234 records

DNA & barcodingBOLD15 specimens

01Narrative

Lozotaeniodes formosana is a moth of the family Tortricidae. It is found in Central Europe. The wingspan is 20–26 mm. The moth flies from June to August. The larvae feed on Scots pine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lozotaeniodes formosana has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

91Tmostly conserved

536Cvariable

622Avariable

TACACTATATTTTATTTTCGGAATTTGGGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGTGCTGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes3

BIN1

Most divergent pair0.30%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lozotaeniodes cupressanasame genus1.5%Cacoecia mnemosynanasame family7.6%Argyrotaenia goganasame family8.1%Ericodesma liquidanasame family8.2%Clepsis burgasiensissame family8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 234 records

Wild obs. + sensor7 139

Museum / vouchered95

Origin

Native6

Range

Area of Occupancy AOO6 504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 1 389≤1 km 233≤10 km 4 998>10 km 9

6 629 georeferenced · 510 without coordinates

Open the mapobservation + sensor7 139

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy95% within 1 km

≤100 m 61≤1 km 20≤10 km 4

85 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	82
Durban Natural Science Museumlocation not on record	5
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Brussels, BE	1

4 institutions · 89 of 95 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lozotaeniodes formosana

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type7 234 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 4 geolocated

Record type7 234 records