Lozotaenia forsterana

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Lozotaenia

At a glance

Occurrence records8 303

Data sources10

Biological traits2

DNA specimens58

eDNA detections79

Sources10 archives

Databases and archives Lozotaenia forsterana's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 303 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 303 records

Environmental DNA3 datasets · 9 countries79 detections

DNA & barcodingBOLD58 specimens

Genome at a glanceGoaT · NCBI≈658 Mbp

01Narrative

Lozotaenia forsterana is a moth of the family Tortricidae. It is found in Europe and across the Palearctic. Figs. 5 larva after final moult The wingspan is 20–29 mm. The forewings are narrowed anteriorly and pale brownish, darker-strigulated. The central fascia is represented by a dark fuscous costal spot, and there is an ill-defined praetornal suffusion. The costal patch is dark fuscous. The hindwings are grey. The larva is pale grey -green or grey, sides sometimes whitish; head black; plate of 2 yellow-brown, with two black spots.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from June to August. The larvae feed on various plants, but prefer Hedera helix.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lozotaenia forsterana has left across the world's sequence archives.

At a glance

DNA specimens58

BINs3

Marker genes1

eDNA detections79

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

38Gmostly conserved

85Tmostly conserved

100Tmostly conserved

139Tmostly conserved

235Cvariable

318Cmostly conserved

433Amostly conserved

490Tmostly conserved

508Cmostly conserved

523Cvariable

562Gmostly conserved

577Gvariable

581Tmostly conserved

583Gmostly conserved

622Gmostly conserved

625Amostly conserved

646Tmostly conserved

TACACTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes20

BINs3

Most divergent pair3.2%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Lozotaenia rindgeisame genus2.7%Lozotaenia costinotanasame genus2.7%Aphelia albocilianasame family5.6%Aphelia peramplanasame family6.4%Choristoneura parallelasame family6.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Lozotaenia forsterana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈657 976 485 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lozotaenia forsterana0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.7% BUSCO

08Occurrence & distribution

Record type8 303 records

Wild obs. + sensor7 444

Museum / vouchered780

Other79

Range

Area of Occupancy AOO11 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 3 102≤1 km 1 356≤10 km 2 710>10 km 12

7 180 georeferenced · 264 without coordinates

Open the mapobservation + sensor7 444

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 257≤1 km 281≤10 km 149>10 km 3

690 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence780

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	177
DanishLepidopterologicalSocietylocation not on record	95
Tartu, EE	62
Tromsø, NO	52
Kuopio, FI	49
NTNU-VMlocation not on record	41
Provincia di Livornolocation not on record	39
SLU Artdatabankenlocation not on record	29
Rovaniemi, FI	23
Philadelphia, US	12
Metsähallituslocation not on record	9
CBDClocation not on record	8
BioFokuslocation not on record	6
Salzburg, AT	5
Stockholm, SE	5
RMZlocation not on record	5
South Kensington, GB	5
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	4
University of Kaiserslauternlocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	3
ZMAAlocation not on record	3
University of Oslo, Natural History Museumlocation not on record	2
NMBU:MINAlocation not on record	2
Nijmegen, NL	1
ZSMlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Helsinki, FI	1
MZLUlocation not on record	1
neflocation not on record	1

31 institutions · 647 of 780 vouchered records shown · 133 without an institution code

09Environmental DNA79 detections

Where the DNA of Lozotaenia forsterana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys3

Countries9

Verifiable raw sequence linked20

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map9 countries0

Alpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 4.50–16.8

Seasonal swing summer↔winter21.6 °C

Max temp (day)17.8 °C 7.30–21.2

Min temp (night)10.4 °C 1.50–13.4

Precipitation88.8 mm/mo 54.3–148

Air humidity60.1 % 57.9–65.3

Moisture balance-8.30 mm/mo -60.8–28.3

Vapour deficit638 Pa 375–799

Wind speed2.70 m/s 2.00–4.80

Cloud cover48.1 % 37.2–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Lozotaenia forsterana

At a glance

Sources10 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type8 303 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 303 records