Lotus glareosus

Boiss. & Reut. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Lotus

At a glance

Occurrence records225

Data sources9

Biological traits3

DNA specimens5

eDNA detections169

Sources9 archives

Databases and archives Lotus glareosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI169 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF225 records

Environmental DNA2 datasets · 5 countries169 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 10

01Narrative

Le Lotier des rocailles est une espèce de plantes à fleurs de la famille des Fabacées et du genre Lotus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.696 mg

Life cycle & reproduction1

Life formperennial or subshrub

Habitat & environment1

Climatetemperate

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lotus glareosus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences9

eDNA detections169

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMK780160.1 ↗604 bpSpain · 1980

ACGT

TCGTATCCTTGCAAACAAACCAACCTGTAAACTCGTTTGACTATTTGGGCAGGCTTGGGGTGTATCCCACCTCGCCTCCCAACTATATTA …

Lotus glareosus isolate GLR3 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lotus glareosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Ploidydiploid inferred

Chromosome records10–102n range10median10mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 106×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. IX. Cruciferae Fernandes, A., M. F. Santos & M. Queirs.Bol. Soc. Brot. ser. 251: 137-186(1977).

CCDB · iber-fl — Nmeros cromossmicos para a flora portuguesa, 38-63. Queirs, M.Bol. Soc. Brot. ser. 254: 47-64(1980).

CCDB · iber-fl — Estudio citotaxonmico de la flora de las costas gallegas Lago Canzobre, E. & S. Castroviejo.Cadernos rea Ci. Biol.3: 1-215(1993).

CCDB · ipcn-api-dl — Fernandes, A. & M. Queiros. 1980. Sur l'occurence de la pseudo-reduction somatique chez Lotus glacialis (Boiss.) Pau. Bol. Soc. Brot. ser. 2, 54: 133–152.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type225 records

Wild obs. + sensor83

Museum / vouchered142

Origin

Native4

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 77≤1 km 4≤10 km 2

83 georeferenced

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 1≤1 km 75≤10 km 12

88 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence142

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CICYTEXlocation not on record	29
Badajoz, ES	22
Granada, ES	22
Phyletisches Museum Jenalocation not on record	13
Salamanca, ES	8
MAlocation not on record	7
Barcelona, ES	5
CJBGlocation not on record	5
Jaén, ES	4
València, ES	4
Entomological Society of Latvialocation not on record	3
Moscow State Universitylocation not on record	2
BClocation not on record	2
Gijón, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Alicante, ES	1
Vitoria, ES	1
EEZA-CSIClocation not on record	1

18 institutions · 131 of 142 vouchered records shown · 9 without an institution code

09Environmental DNA169 detections

Where the DNA of Lotus glareosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found169

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 169 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.90 °C 6.90–12.4

Seasonal swing summer↔winter18.1 °C

Max temp (day)10.5 °C 10.5–14.2

Min temp (night)1.10 °C 1.10–8.80

Precipitation273 mm/mo 130–273

Air humidity63.5 % 61.3–63.5

Moisture balance164 mm/mo 37.4–164

Vapour deficit364 Pa 364–560

Wind speed4.00 m/s 3.60–4.00

Cloud cover39.7 % 39.7–65.3

CHELSA 1981–2010, ~9 km grid, at location & month of 166 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)