Lophodermium seditiosum

Minter, Staley & Millar · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Rhytismatales/Rhytismataceae/Lophodermium

At a glance

Occurrence records622

Data sources9

Biological traits0

DNA specimens19

eDNA detections20

Sources9 archives

Databases and archives Lophodermium seditiosum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility622 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF622 records

Environmental DNA2 datasets · 5 countries20 detections

DNA & barcodingBOLD · NCBI19 specimens

01Narrative

Lophodermium seditiosum is a plant pathogen which infects pine trees..

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lophodermium seditiosum has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes2

GenBank sequences10

eDNA detections20

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ895277.1 ↗560 bpUnited Kingdom · 2016

ACGT

GGAGAGCCCTAACCATAGGCAATCCGCAGTCCCTACCCGGGATTCAGAGACTCAATGAGCGTGGGTTCAGCGCAGCTGAGCTTGAGATAG …

Lophodermium seditiosum isolate 25-3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type622 records

Wild obs. + sensor488

Museum / vouchered102

Cultivated / captive32

Range

Area of Occupancy AOO1 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 195≤1 km 82≤10 km 149>10 km 56

482 georeferenced · 6 without coordinates

Open the mapobservation + sensor488

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 8≤1 km 12≤10 km 28

48 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence102

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 32 records without

Open the mapnot free-living32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	16
Bernard Price Institute for Palaeontological Researchlocation not on record	8
Slovenian Forestry Institutelocation not on record	7
TROMlocation not on record	4
Olocation not on record	4
Kew, GB	3
nsnflocation not on record	3
Zürich, CH	2
Bronx, US	2
Catholic University of Pekinglocation not on record	2
Copenhagen, DK	2
Gijón, ES	1
Philadelphia, US	1
GJOlocation not on record	1
San Sebastián, ES	1
PRClocation not on record	1
Edinburgh, GB	1
SLU Artdatabankenlocation not on record	1

18 institutions · 60 of 102 vouchered records shown · 30 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Lophodermium seditiosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.50 °C 2.50–12.9

Seasonal swing summer↔winter26.2 °C

Max temp (day)5.20 °C 4.40–14.9

Min temp (night)-0.7 °C -0.7–8.80

Precipitation61.0 mm/mo 61.0–104

Air humidity65.4 % 61.0–67.1

Moisture balance16.0 mm/mo 13.1–44.2

Vapour deficit330 Pa 275–586

Wind speed2.80 m/s 2.60–3.10

Cloud cover52.5 % 51.8–66.8

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)