Lonicera periclymenum
speciesAt a glance
Occurrence records531 270
Data sources13
Biological traits55
DNA specimens43
eDNA detections26
Sources13 archives
Databases and archives Lonicera periclymenum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility531 270 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionLOTUS · NPASS15 compounds
Occurrence & distributionGBIF531 270 records
Environmental DNA1 datasets · 6 countries26 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GoaT3.1 Gbp
01Narrative
Le Chèvrefeuille des bois (Lonicera periclymenum) est une liane arbustive de la famille des Caprifoliacées aux fleurs très odorantes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology18
Fruit length7.9 mm
Fruit width6.8 mm
Leaf length max60 mm
Leaf size2 509 mm²
⚠ sources differ — TRY: 2 509 mm² · LEDA: 804 mm² · GIFT: 804 mm²
Leaf width40 mm
Leaf width max40 mm
Leaf width min40 mm
Plant height4.5 m
⚠ sources differ — GIFT: 4.5 m · LEDA: 5 m · TRY: 4.58 m
Plant height generative2.88 m
Plant height max10 m
Plant height min1 m
Seed length4.18 mm
Seed mass5.58 mg
⚠ sources differ — TRY: 5.58 mg · LEDA: 5.97 mg · GIFT: 5.79 mg
Seed mass max5.97 mg
Seed mass min4.54 mg
Seed volume5.9 mm³
Seed volume max5.9 mm³
Seed volume min5.9 mm³
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endOct
Flowering startJun
Life formclimber
Life spanperennial
Lifespan years50 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formLiana
⚠ sources differ — LEDA: Liana · GIFT: phanerophyte
Reproduction asexualabsent
Seed number8
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberobligatory
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: climber_woody · TRY: L
Habitat GIFTLowland
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry10
Leaf C:N ratio21.36 g/g
Leaf c415 mg/g
Leaf dry-matter content (LDMC)295 mg/g
⚠ sources differ — TRY: 295 mg/g · LEDA: 227 mg/g
Leaf n22.45 mg/g
Leaf p1.75 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.54 mm²/mg
Wood density187 mg/cm³
Other traits1
Diaspore typegerminule
03Chemical composition15 compounds
Compounds documented for Lonicera periclymenum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Iridoids monoterpenoids6
Secoiridoid monoterpenoids4
Iridoids monoterpenoids $ Secoiridoid monoterpenoids2
Cardenolides2
Documented compounds15 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,4aS,6S,7R,7aS)-6-hydroxy-7-methyl-1-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid | present | LOTUS | |
| (7Alpha-Hydroxy)-Morroniside | present | LOTUS | |
| Digitoxigenin | present | NPASS | |
| Gitoxigenin | present | NPASS | |
| Loganic Acid | present | LOTUS | |
| loganin | present | LOTUS | |
| methyl (1S,4aS,6S,7R,7aR)-6-[(E)-3-[3-methoxy-4-[(2R,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]prop-2-enoyl]oxy-7-methyl-1-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate | present | LOTUS | |
| methyl (1S,4aS,6S,7R,7aS)-6-hydroxy-7-methyl-1-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylate | present | LOTUS | |
| methyl (2S,3R,4S)-3-ethenyl-4-(2-oxoethyl)-2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydro-2H-pyran-5-carboxylate | present | LOTUS | |
| Morroniside | present | LOTUS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lonicera periclymenum has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes6
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
GCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTACGCATCGCGTCGCCCCCCCACCCCGCGTCCCGCAGGGTCG …
Lonicera periclymenum voucher EDNA21-0061054 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Lonicera periclymenum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 110 040 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Lonicera periclymenum3.11 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 54 n = 27
Ploidy6× hexaploid · measured
Chromosome records18–542n range45median54mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5414×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · ipcn-api-dl +3
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · brit-fl — McAllister, H. Pers.comm. to R.J.Gornall : 8.x (1992)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Hommel, P. W. F. M. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 277–278.
CCDB · book-indian_vol1 — Gadella, T.W.J. & Kliphuis, E. 1963
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.
CCDB · CromoCat 2015 — Javurková, V. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 713-714.
CCDB · CromoCat 2015 — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal (1997). Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365-368.
2n 189×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +4
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Uhríková A. & Májovský J., 1980: [Report], pp. 725-726. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · fl-europaea — Rutland, 1941
CCDB · ipcn-api-dl — Benko-Iseppon, A. M. 1992. Karyologische Untersuchung der Caprifoliaceae s.l. und möglicher verwandter Familien. Wien, Formal– und Naturwiss. Fak. Univ. Wien. (Dissertation.).
CCDB · ipcn-api-dl — Uhrikova, A. & J. Majovsky. 1980. In Chromosome number reports LXIX. Taxon 29: 725–726.
CCDB · book-indian_vol1 — Rutland, J.P. 1941
CCDB · CromoCat 2015 — Benko-Iseppon, A. M. (1992). Karyologische Untersuchung der Caprifoliaceae s.l. und möglicher verwandter Familien. Wien, Formal-- und Naturwiss. Fak. Univ. Wien. (Dissertation.) NONE LISTED
CCDB · CromoCat 2015 — Uhríková, A. & J. Májovsky. (1980b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 725-726.
2n 365×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +1
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Javurkova, V. 1980. In Chromosome number reports LXIX. Taxon 29: 713–714.
CCDB · book-indian_vol1 — Hagerup, O. 1941 b ; Poucques, M.L. de 1949 ; Laane, M.M. 1969a
CCDB · CromoCat 2015 — Hommel, P. W. F. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 277-278.
n 184×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
CCDB · CromoCat 2015 — Diosdado, J. C., Santa-Barbara, C. Vioque, J., Juan, R. & Pastor, J. (1993a). Números cromosómicos para la flora española. 691-719. Lagascalia 17(1): 173-184.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type531 270 records
Wild obs. + sensor526 592
Museum / vouchered3 253
Cultivated / captive100
Other1 325
Origin
Native40 930
Introduced1 062
Range
Area of Occupancy AOO377 212 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy45% within 1 km
≤100 m 85 298≤1 km 115 648≤10 km 244 369>10 km 2 351
447 666 georeferenced · 78 926 without coordinates
Open the mapobservation + sensor526 592
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy45% within 1 km
≤100 m 242≤1 km 729≤10 km 1 153>10 km 43
2 167 georeferenced · 1 086 without coordinates
Open the institutions mapphysical evidence3 253
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy14% within 1 km
≤1 km 3≤10 km 3>10 km 15
21 georeferenced · 79 without coordinates
Open the mapnot free-living100
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions69 of 138 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 798 |
| Olocation not on record | 423 |
| LDlocation not on record | 267 |
| Bergen, NO | 150 |
| MeiseBGlocation not on record | 150 |
| Oskarshamn, SE | 100 |
| Trondheim, NO | 80 |
| South Kensington, GB | 77 |
| BFLlocation not on record | 76 |
| KMNlocation not on record | 62 |
| SLU Artdatabankenlocation not on record | 51 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 44 |
| Barcelona, ES | 34 |
| Bern, CH | 32 |
| BDBClocation not on record | 28 |
| València, ES | 25 |
| Görlitz, DE | 23 |
| DBF-NHMDlocation not on record | 21 |
| BClocation not on record | 20 |
| Christchurch, NZ | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| WTUlocation not on record | 18 |
| Entomological Society of Latvialocation not on record | 15 |
| MAlocation not on record | 14 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Adam Mickiewicz University in Poznańlocation not on record | 13 |
| Provincia di Livornolocation not on record | 12 |
| CICYTEXlocation not on record | 12 |
| Vitoria, ES | 12 |
| Uppsala, SE | 11 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 11 |
| Berlin, DE | 10 |
| Frankfurt am Main | 9 |
| Karlsruhe, DE | 9 |
| BIO-UNIPIlocation not on record | 9 |
| Salamanca, ES | 9 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Vancouver, CA | 8 |
| Pamplona, ES | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Auckland, NZ | 8 |
| Paris, FR | 8 |
| Porrentruy, CH | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Corvallis, US | 7 |
| University of Hamburglocation not on record | 7 |
| Mlocation not on record | 7 |
| Salzburg, AT | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Madrid, ES | 6 |
| Bourges, FR | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Pamplona, ES | 5 |
| Chongqing Museumlocation not on record | 5 |
| Wellington, NZ | 5 |
| Córdoba, ES | 5 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Zürich, CH | 4 |
| National Museum Waleslocation not on record | 4 |
| OLAlocation not on record | 4 |
| Hobart, AU | 4 |
| Kew, GB | 4 |
| Tilburg, NL | 4 |
| nbflocation not on record | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Stockholm, SE | 3 |
| Moscow State Universitylocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Coimbra, PT | 3 |
| Davenport, US | 3 |
| Fulda, DE | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| Zürich, CH | 3 |
| Badajoz, ES | 3 |
| Saint Louis, US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Xiamen, CN | 2 |
| Frauenfeld, CH | 2 |
| Podgorica, ME | 2 |
| Wlocation not on record | 2 |
| Oulu, FI | 2 |
| QVMAGlocation not on record | 2 |
| Austin, US | 2 |
| Monastir, TN | 2 |
| BSBIlocation not on record | 2 |
| Tacoma, US | 2 |
| Pullman, US | 2 |
| Tampa, US | 2 |
| Dresden, DE | 2 |
| Canberra, AU | 2 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Henderson, US | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Granada, ES | 1 |
| FLADlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| BRNUlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| GAlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Riverside, US | 1 |
| Guangzhou, CN | 1 |
| University of Stellenboschlocation not on record | 1 |
| TROMlocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| La Paz, BO | 1 |
| H-Hohlalocation not on record | 1 |
| Taipei, TW | 1 |
| Alicante, ES | 1 |
| Namur, BE | 1 |
| CJBNlocation not on record | 1 |
| Sion, CH | 1 |
| ISAlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| PRClocation not on record | 1 |
| Wuzhou, CN | 1 |
| Claremont, US | 1 |
| Madison, US | 1 |
| Victoria, CA | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Decorah, US | 1 |
| Smithfield, AU | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Bronx, US | 1 |
| Portland, US | 1 |
| GJOlocation not on record | 1 |
| Garðabær, IS | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Winterthur, CH | 1 |
| JBRJlocation not on record | 1 |
| Jyväskylä, FI | 1 |
138 institutions · 2 957 of 3 253 vouchered records shown · 296 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Lonicera periclymenum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map6 countries0
Woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 12.0–17.2
Seasonal swing summer↔winter13.9 °C
Max temp (day)18.1 °C 14.9–19.3
Min temp (night)11.5 °C 8.50–15.4
Precipitation78.5 mm/mo 55.6–98.1
Air humidity63.0 % 61.2–65.3
Moisture balance-27.5 mm/mo
Vapour deficit660 Pa 541–723
Wind speed4.40 m/s
Cloud cover48.4 % 32.6–55.3
CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.