Lonchoptera lutea

Meigen · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Lonchopteridae/Lonchoptera

At a glance

Occurrence records860

Data sources5

Biological traits0

DNA specimens43

eDNA detections885

Sources5 archives

Databases and archives Lonchoptera lutea's data was compiled from.

GBIFGlobal Biodiversity Information Facility860 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI885 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF860 records

Environmental DNA6 datasets · 21 countries885 detections

DNA & barcodingBOLD43 specimens

Genome at a glanceGoaT≈406 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lonchoptera lutea has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes1

eDNA detections885

Countries21

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

42Gmostly conserved

54Tmostly conserved

78Avariable

87Amostly conserved

105Cmostly conserved

312Tmostly conserved

357Gvariable

372Amostly conserved

405Cvariable

432Amostly conserved

471Tmostly conserved

510Gvariable

519Amostly conserved

535Cmostly conserved

561Tmostly conserved

570Tmostly conserved

600Tvariable

615Cmostly conserved

624Avariable

627Amostly conserved

633Cmostly conserved

645Tmostly conserved

ACTTTATATTTTATTTTTGGAGCCTGAGCTGGAATAGTTGGGACTTCTTTAAGTATTTTAATTCGAGCTGAATTAGGAAATCCCGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes11

BIN1

Most divergent pair2.2%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Opacifrons convexasame order9.9%Lonchoptera nitidifronssame genus10.1%Lonchoptera flavasame genus10.1%Leucophenga rectifoliaceasame order10.2%Leucophenga piscifoliaceasame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Lonchoptera lutea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈406 202 705 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lonchoptera lutea0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness95.3% BUSCO

08Occurrence & distribution

Record type860 records

Wild obs. + sensor838

Museum / vouchered21

Cultivated / captive1

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 53≤1 km 575≤10 km 103

731 georeferenced · 107 without coordinates

Open the mapobservation + sensor838

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence21

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Natural History Museum, Londonlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
South Kensington, GB	1
Copenhagen, DK	1

5 institutions · 9 of 21 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA885 detections

Where the DNA of Lonchoptera lutea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found885

Studies independent surveys6

Countries21

Verifiable raw sequence linked405

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 885 detections have coordinates

Open the map21 countries0

Garden and heatland, coastal habitat14. Artificial - Terrestrial | 14.5 Urban Ar…Soil3. Shrubland|3.8. Shrubland - Mediterranean-…Farmland, coast and birch habitatMediterranean forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 6.50–16.2

Seasonal swing summer↔winter17.1 °C

Max temp (day)15.0 °C 8.20–20.2

Min temp (night)8.40 °C 2.20–12.8

Precipitation69.1 mm/mo 48.3–132

Air humidity62.0 % 58.3–66.0

Moisture balance-9.40 mm/mo -59.7–66.3

Vapour deficit521 Pa 352–709

Wind speed4.00 m/s 2.50–5.60

Cloud cover48.3 % 39.2–61.6

CHELSA 1981–2010, ~9 km grid, at location & month of 883 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)