Lomatia tasmanica

W.M.Curtis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Lomatia

At a glance

Occurrence records0

Data sources8

Biological traits15

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Lomatia tasmanica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources15 traits

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2 Gbp

01Narrative

Lomatia tasmanica, commonly known as King's lomatia, is a shrub of the family Proteaceae native to Tasmania. Growing up to 8 m tall, the plant has shiny green pinnate (lobed) leaves and bears red flowers in the summer, but yields neither fruit nor seeds. King's lomatia is unusual because all of the remaining plants are genetically identical clones. Because it has three sets of chromosomes (a triploid) and is therefore sterile, reproduction occurs only vegetatively: when a branch falls, that branch grows new roots, establishing a new plant that is genetically identical to its parent. Charles Denison "Deny" King discovered the plant in 1934, though it was not described until 1967 by botanist Winifred Mary Curtis of the Tasmanian Herbarium. Only one colony of King's lomatia is known to be alive in the wild, consisting of about 600 plants over an area 1.2 km in length.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology3

Leaf length40 mm

Leaf width15 mm

Plant height5 m

Life cycle & reproduction4

Flowering timenynnnnnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite+monoecious

Habitat & environment7

Climatesubtropical

Fruit fleshinessdry

Fruit typefollicle

Growth formshrub tree

Leaf compoundnesscompound

Leaf shapeoblong ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lomatia tasmanica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKC633722.1 ↗611 bp

ACGT

CTGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGCCCAGCAGATAGACCCGTGAACACGTTGCATCATGATCTAGGGAAAGGGTG …

Lomatia tasmanica 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Lomatia tasmanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 965 779 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Lomatia tasmanica1.97 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidy3× triploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 332×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Lynch, A. J. J., R. W. Barnes, J. Cambecèdes & R. E. Vaillancourt. 1998. Genetic evidence that Lomatia tasmanica (Proteaceae) is an ancient clone. Austral. J. Bot. 46: 25–33.

CCDB · kew — Jordan GJ, Carpenter RJ, Koutoulis A, Price A, Brodribb TJ. 2014. Environmental adaptation in stomatal size independent of the effects of genome size. New Phytologist 205: 608-617.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

triploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

07Deep time~13.2 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin13.2 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

09Environmental DNA1 detections

Where the DNA of Lomatia tasmanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)