Lithops karasmontana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Lithops

At a glance

Occurrence records6

Data sources7

Biological traits13

DNA specimens0

eDNA detections1

Sources7 archives

Databases and archives Lithops karasmontana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF6 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Lithops karasmontana subsp. amicorum is a small desert succulent plant with white flowers. They are usually 10-15 millimeters in diameter. It was named for the group of four friends who discovered it. It was collected by Desmond T. and Naureen A. Cole on 3 May 2004. After recent molecular analysis it has been determined to be a subspecies of Lithops karasmontana rather than its own species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.01 m

Life cycle & reproduction2

Life formsucculent perennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max2 200 m

Elevation min1 200 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lithops karasmontana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSFN386492.1 ↗546 bp

ACGT

AACGACCCGTGAACACGTTTAAAACACATGGGAGGGACGCATGCGGCCTCGTGCCGCTCGCCCCCTCCCCACGCCGGGGGCNCGCCCCTT …

Lithops karasmontana var. karasmontana ITS1 (partial), 5.8S rRNA gene and ITS2 (partial), specimen voucher L455

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor6

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy17% within 1 km

≤100 m 1>10 km 5

6 georeferenced

Open the mapobservation + sensor6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA1 detections

Where the DNA of Lithops karasmontana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.