Lithops julii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Aizoaceae/Lithops

At a glance

Occurrence records16

Data sources7

Biological traits11

DNA specimens0

eDNA detections2

Sources7 archives

Databases and archives Lithops julii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Lithops julii is a species of succulent plant of the genus Lithops under the family Aizoceae. It is native to Southern Africa, and was first collected by Professor Kurt Dinter, a German botanist, and named after his friend, Dr. Julius Derenberg.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.01 m

Life cycle & reproduction2

Life formsucculent perennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Elevation max1 150 m

Elevation min550 m

Epiphyteterrestrial

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Lithops julii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFN386491.1 ↗547 bp

ACGT

AACGACCCGTGAACACGTTTAAATACATGGGAGGGACGCATGCGGCCTCGTGCCGCCTGCCCCCTCCCCACGCCGGGGGCGCGCCCCTTG …

Lithops julii subsp. fulleri ITS1 (partial), 5.8S rRNA gene and ITS2 (partial), specimen voucher S362

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor15

Cultivated / captive1

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 15

15 georeferenced

Open the mapobservation + sensor15

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Lithops julii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.